Subcutaneous Delivery of RNAi Agents for Inhibiting Expression of Receptor for Advanced Glycation End-products
Described are methods for subcutaneously administering a therapeutic composition comprising a RNAi agent for inhibiting Receptor for Advanced Glycation End-products (AGER or RAGE). The RAGE RNAi agents and RNAi agent conjugates disclosed herein inhibit the expression of an AGER gene when administered subcutaneously. Pharmaceutical compositions that include one or more RAGE RNAi agents, optionally with one or more additional therapeutics, are also described. Delivery of the described RAGE RNAi agents to pulmonary cells, in vivo, provides for inhibition of AGER gene expression and a reduction in membrane RAGE activity, which can provide a therapeutic benefit to subjects, including human subjects, for the treatment of various diseases including pulmonary inflammation diseases such as severe asthma. Subcutaneous delivery of the RAGE RNAi agents described herein can provide certain advantages over inhaled delivery.
1 . A method for inhibiting expression of a Receptor for Advanced Glycation End-products gene in a subject, the method comprising administering to the subject by subcutaneous injection an RNAi agent comprising:
an antisense strand comprising at least 17 contiguous nucleotides differing by 0 or 1 nucleotides from any one of the antisense strand sequences provided in Table 2, Table 3, or Table 10; and
a sense strand comprising a nucleotide sequence that is at least partially complementary to the antisense strand.
2 . The method of claim 1 , comprising an antisense strand that consists of, consists essentially of, or comprises a nucleotide sequence that differs by 0 or 1 nucleotides from one of the following nucleotide sequences (5′→3′):
(SEQ ID NO: 35)
UUGUGUUCAGUUUCCAUUC;
(SEQ ID NO: 45)
UGAUGUUUUGAGCACCUAC;
(SEQ ID NO: 49)
UUCCAUUCCUGUUCAUUGC;
(SEQ ID NO: 780)
UUGUGUUCAGUUUCCAUUCCG;
(SEQ ID NO: 796)
UGAUGUUUUGAGCACCUACUC;
or
(SEQ ID NO: 797)
UUCCAUUCCUGUUCAUUGCCU;.
3 . The method of claim 2 , wherein the sense strand consists of, consists essentially of, or comprises a nucleotide sequence that differs by 0 or 1 nucleotides from one of the following nucleotide sequences 5′→3′):
(SEQ ID NO: 278)
GAAUGGAAACUGAACACAA;
(SEQ ID NO: 288)
GUAGGUGCUCAAAACAUCA;
(SEQ ID NO: 296)
GCAAUGAACAGGAAUIGAA;
(SEQ ID NO: 818)
CGGAAUGGAAACUGAACACAA;
(SEQ ID NO: 838)
GAGUAGGUGCUCAAAACAUCA;
or
(SEQ ID NO: 839)
AGGCAAUGAACAGGAAUIGAA.
4 . The method of claim 3 , wherein all or substantially all of the nucleotides are modified nucleotides.
5 . The method of claim 1 , comprising an antisense strand that comprises, consists of, or consists essentially of a modified nucleotide sequence that differs by 0 or 1 nucleotides from one of the following nucleotide sequences (5′→3′):
(SEQ ID NO: 521)
usUfsgsUfgUfuCfaGfuUfuCfcAfuUfcCfsg;
(SEQ ID NO: 522)
cPrpusUfsgsUfgUfuCfaGfuUfuCfcAfuUfcCfsg;
(SEQ ID NO: 580)
usGfsasuguuuugaGfcAfcCfuacusc;
(SEQ ID NO: 581)
cPrpusGfsasuguuuugaGfcAfcCfuacusc;
(SEQ ID NO: 547)
usUfscsCfaUfuCfcUfgUfuCfaUfuGfcCfsu;
wherein a represents 2′-O-methyl adenosine, c represents 2′-O-methyl cytidine, g represents 2′-O-methyl guanosine, and u represents 2′-O-methyl uridine; Af represents 2′-fluoro adenosine, Cf represents 2′-fluoro cytidine, Gf represents 2′-fluoro guanosine, and Uf represents 2′-fluoro uridine; cPrpu represents a 5′-cyclopropyl phosphonate-2′-O-methyl uridine; s represents a phosphorothioate linkage; and wherein all or substantially all of the nucleotides on the sense strand are modified nucleotides.
6 . The method of claim 1 , wherein the sense strand comprises, consists of, or consists essentially of a modified nucleotide sequence that differs by 0 or 1 nucleotides from one of the following nucleotide sequences (5′→3′):
(SEQ ID NO: 671)
gsaguagGfuGfcUfcaaaacauca;
(SEQ ID NO: 627)
asggcaaugAfAfCfaggaauigaa;
(SEQ ID NO: 602)
csggaauggAfAfAfcugaacacaa;
wherein a represents 2′-O-methyl adenosine, c represents 2′-O-methyl cytidine, g represents 2′-O-methyl guanosine, i represents 2′-O-methyl inosine, and u represents 2′-O-methyl uridine; Af represents 2′-fluoro adenosine, Cf represents 2′-fluoro cytidine, Gf represents 2′-fluoro guanosine, and Uf represents 2′-fluoro uridine; and s represents a phosphorothioate linkage; and wherein all or substantially all of the nucleotides on the antisense strand are modified nucleotides.
7 . The method of claim 6 , wherein the sense strand further includes inverted abasic residues at the 3′ terminal end of the nucleotide sequence, at the 5′ end of the nucleotide sequence, or at both.
8 . The method of claim 1 , wherein the RNAi agent is linked to a targeting ligand.
9 . The method of claim 8 , wherein the targeting ligand comprises the structure:
or a pharmaceutically acceptable salt thereof, or
or a pharmaceutically acceptable salt thereof,
wherein indicates the point of connection to the RNAi agent.
10 . The method of claim 9 , wherein RNAi agent is conjugated to a targeting ligand having the following structure:
11 . The method of claim 10 , wherein the targeting ligand is conjugated to the 5′ terminal end of the sense strand.
12 . The method of claim 1 , wherein the RNAi agent is a pharmaceutically acceptable salt.
13 . The method of claim 12 , wherein the RNAi agent is a sodium salt.
14 . The method of claim 1 , where in the RNAi agent is formulated into a pharmaceutical composition suitable for subcutaneous administration, wherein the pharmaceutical composition comprises the RNAi agent and at least one pharmaceutically acceptable excipient.
15 . A method of treating one or more diseases, disorders, or symptoms associated with enhanced or elevated membrane RAGE activity levels or that can otherwise be mediated by a reduction in AGER gene expression levels, the method comprising subcutaneously administering to a human subject in need thereof a therapeutically effective amount of an RNAi agent comprising:
a) an antisense strand comprising at least 17 contiguous nucleotides differing by 0 or 1 nucleotides from any one of the sequences provided in Table 2, Table 3, or Table 10; and
b) a sense strand comprising a nucleotide sequence that is at least partially complementary to the antisense strand.
16 . The method of claim 15 , wherein the disease is a respiratory disease.
17 . The method of claim 16 , wherein the respiratory disease is cystic fibrosis, chronic bronchitis, non-cystic fibrosis bronchiectasis, chronic obstructive pulmonary disease (COPD), asthma, respiratory tract infections, primary ciliary dyskinesia, or lung carcinoma cystic fibrosis.
18 . The method of claim 15 , wherein the RNAi agent is administered in two or more doses.
19 . The method of claim 18 , wherein the two or more doses are administered about weekly.
20 . The method of claim 18 , wherein the two or more doses are administered about once every two weeks.
21 . The method of claim 18 , wherein the two or more doses are administered about every four weeks.
22 . The method of claim 1 , wherein the RNAi agent is administered at a dose of about 0.01 mg/kg to about 40.0 mg/kg of body weight of the subject.
23 . The method of claim 22 , wherein the RNAi agent is administered at a dose of about 5.0 mg/kg to about 18.0 mg/kg of body weight of the subject.
24 . The method of claim 23 , wherein the RNAi agent is administered at a dose of about 10.0 mg/kg to about 16.0 mg/kg of body weight of the subject.
25 . The method of claim 24 , wherein the RNAi agent is administered at a dose of about 12.0 mg/kg to about 15.0 mg/kg of body weight of the subject.