RNAi agents for inhibiting expression of activin receptor-like kinase 7 (ALK7), compositions thereof, and methods of use
Described are RNAi agents, compositions that include RNAi agents, and methods for inhibition of an Activin Receptor-Like Kinase 7 (ALK7) gene. The ALK7 RNAi agents and RNAi agent conjugates disclosed herein inhibit the expression of an ALK7 gene. Pharmaceutical compositions that include one or more ALK7 RNAi agents, optionally with one or more additional therapeutics, are also described. Delivery of the described ALK7 RNAi agents to adipose tissue, in vivo, provides for inhibition of ALK7 gene expression and a reduction in ALK7 activity, which can provide a therapeutic benefit to subjects, including human subjects, for the treatment of various diseases including obesity, diabetes, or insulin resistance.
1. An RNAi agent for inhibiting expression of a Activin Receptor-Like Kinase 7 (ALK7) gene, comprising:
an antisense strand wherein nucleotides 1-21 of the antisense strand (5′→3′) comprise the nucleotide sequence (5′→3′): AUUGUUGGAACUAUGACAGAC (SEQ ID NO: 558); and
a sense strand that comprises a nucleotide sequence that differs by 0 or 1 nucleotides from the nucleotide sequence (5′→3′): GUCUGUCAUAGUUCCAACAAU (SEQ ID NO: 599);
wherein all of the nucleotides of the antisense strand and all of the nucleotides of the sense strand are modified nucleotides, wherein the modified nucleotides are selected from the group consisting of 2′-fluoro modified nucleotides, 2′-O-methyl modified nucleotides, and cyclopropyl phosphonate-containing nucleotides, wherein the sense strand is linked to one or more lipid moieties, and wherein each of the one or more lipid moieties is independently selected from the group consisting of:
wherein indicates the point of connection to the RNAi agent.
2. The RNAi agent of claim 1 , wherein the one or more lipid moieties are conjugated to the sense strand on the 5′ terminus of the sense strand, the 3′ terminus of the sense strand, or both the 5′ and 3′ terminus of the sense strand.
3. The RNAi agent of claim 1 , wherein the sense strand and the antisense strand are each between 21 and 24 nucleotides in length.
4. The RNAi agent of claim 1 , wherein the sense strand and the antisense strand are each 21 nucleotides in length.
5. The RNAi agent of claim 1 , wherein the sense strand comprises one or two inverted abasic residues.
6. The RNAi agent of claim 1 , wherein the antisense strand comprises the modified nucleotide sequence (5′→3′): cPrpasUfsuguuGfgaacUfaUfgAfcagasc (SEQ ID NO: 269);
wherein a represents 2′-O-methyl adenosine, c represents 2′-O-methyl cytidine, g represents 2′-O-methyl guanosine, and u represent 2′-O-methyl uridine; Af represents 2′-fluoro adenosine, Cf represents 2′-fluoro cytidine, Gf represents 2′-fluoro guanosine, and Uf represents 2′-fluoro uridine; cPrpa represents a 5′-cyclopropyl phosphonate-2′-O-methyl adenosine; s represents a phosphorothioate linkage; and wherein all of the nucleotides on the sense strand are modified nucleotides.
7. The RNAi agent of claim 6 , wherein the sense strand comprises the modified nucleotide sequence (5′→3′): gucugucaUfAfGfuuccaacaau (SEQ ID NO: 364)
wherein a represents 2′-O-methyl adenosine, c represents 2′-O-methyl cytidine, g represents 2′-O-methyl guanosine, and u represent 2′-O-methyl uridine; Af represents 2′-fluoro adenosine, Cf represents 2′-fluoro cytidine, Gf represents 2′-fluoro guanosine, and Uf represents 2′-fluoro uridine.
8. The RNAi agent of claim 7 , wherein the sense strand further comprises one or more inverted abasic residues.
9. The RNAi agent of claim 8 , wherein the RNAi agent is linked to LP-379-a on the 5′ terminus of the sense strand, and linked to LP-371-a on the 3′ terminus of the sense strand.
10. The RNAi agent of claim 8 , wherein the sense strand has the structure: LP-379-a-L6-(NH—C6)s(invAb)sgucugucaUfAfGfuuccaacaaus(invAb)-(C6-S)-LP-371-a (SEQ ID NO: 535), and the antisense strand has the structure: cPrpasUfsuguuGfgaacUfaUfgAfcagasc (SEQ ID NO: 269), wherein a represents 2′-O-methyl adenosine, c represents 2′-O-methyl cytidine, g represents 2′-O-methyl guanosine, and u represent 2′-O-methyl uridine; Af represents 2′-fluoro adenosine, Cf represents 2′-fluoro cytidine, Gf represents 2′-fluoro guanosine, and Uf represents 2′-fluoro uridine, cPrpa represents a 5′-cyclopropyl phosphonate-2′-O-methyl adenosine, (invAb) represents an inverted abasic residue, (C6-S) has the structure:
L6 has the structure:
(NH—C6)s has the structure:
LP-379-a has the structure:
and LP-371-a has the structure:
11. The RNAi agent of claim 1 , wherein the RNAi agent is a pharmaceutically acceptable salt.
12. The RNAi agent of claim 11 , wherein the pharmaceutically acceptable salt is a sodium salt.
13. The RNAi agent of claim 10 , wherein the RNAi agent is a sodium salt.
14. A pharmaceutical composition comprising the RNAi agent of claim 1 , wherein the composition comprises a pharmaceutically acceptable excipient.
15. A pharmaceutical composition comprising the RNAi agent of claim 10 , wherein the composition comprises a pharmaceutically acceptable excipient.
16. The pharmaceutical composition of claim 15 , wherein the pharmaceutically acceptable excipient is sodium chloride.
17. A method of treating an ALK7-related disease, disorder, or symptom, the method comprising administering to a human subject in need thereof a therapeutically effective amount of the pharmaceutical composition of claim 16 .
18. The method of claim 17 , wherein the ALK7-related disease is obesity, diabetes, or insulin resistance.
19. The method of claim 18 , wherein the RNAi agent is administered to a human subject at a dose of about 0.01 mg/kg to about 5.0 mg/kg of body weight of the subject.