MUSCLE TARGETING COMPLEXES AND USES THEREOF FOR SKIPPING EXON 45 OF A DMD GENE
Aspects of the disclosure relate to complexes and other aspects relate to formulations (e.g., aqueous, lyophilized forms) comprising such complexes (e.g, wherein each complex is of the exemplary formula shown below) comprising a phosphorodiamidate morpholino oligomer (e.g, useful for targeting DMD) covalently linked to an antibody (e.g., anti-TfR1 antibody). Also provided are uses of these formulations for treating a subject having a mutated DMD allele associated with Duchenne Muscular Dystrophy. (I)
1 . A complex comprising a structure of formula (I): [R 1 ] n1 —R 2 , wherein each R 1 comprises a group of the formula (Ia):
wherein R 3 comprises a phosphorodiamidate morpholino oligomer (PMO) comprising the base sequence of CAATGCCATCCTGGAGTTCCTG (SEQ ID NO: 21);
wherein R 2 comprises an anti-transferrin receptor 1 (anti-TfR1) antibody comprising a heavy chain complementarity determining region 1 (CDR-H1), a heavy chain complementarity determining region 2 (CDR-H2), a heavy chain complementarity determining region 3 (CDR-H3), a light chain complementarity determining region 1 (CDR-L1), a light chain complementarity determining region 2 (CDR-L2), and a light chain complementarity determining region (CDR-L3) selected from Table 2,
wherein R 1 is covalently linked to R 2 at attachment point A; and wherein n1 is an integer of one or greater representing the number of instances of R 1 in the complex, wherein each instance of R 1 is covalently linked to a different amino acid residue of the anti-TfR1 antibody.
2 . A complex comprising a structure of formula (I): [R 1 ] n1 —R 2 , wherein each R 1 comprises a group of the formula (Ib):
in which -p is a phosphorodiamidate linkage of a phosphorodiamidate morpholino oligomer (PMO), and wherein the PMO comprises a base sequence of
(SEQ ID NO: 21)
CAATGCCATCCTGGAGTTCCTG;
wherein R 2 comprises an anti-TfR1 antibody comprising a CDR-H1, a CDR-H2, a CDR-H3, a CDR-L1, a CDR-L2, and a CDR-L3 selected from Table 2;
wherein R 1 is covalently linked to R 2 at attachment point A; and wherein n1 is an integer of one or greater representing the number of instances of R 1 , wherein each instance of R 1 is covalently linked to a different amino acid residue of the anti-TfR1 antibody.
3 . A complex comprising a structure of formula (I): [R 1 ] n1 —R 2 , wherein each R 1 comprises a group of the formula (Ic):
wherein R 2 comprises an anti-TfR1 antibody comprising a CDR-H1, a CDR-H2, a CDR-H3, a CDR-L1, a CDR-L2, and a CDR-L3 selected from Table 2;
wherein R 1 is covalently linked to R 2 at attachment point A; and wherein n1 is an integer of one or greater representing the number of instances of R 1 , wherein each instance of R 1 is covalently linked to a different amino acid residue of the anti-TfR1 antibody.
4 . A complex comprising a structure of formula (Id).
in which -p is a phosphorodiamidate linkage of a phosphorodiamidate morpholino oligomer (PMO), and wherein the PMO comprises a base sequence of
(SEQ ID NO: 21)
CAATGCCATCCTGGAGTTCCTG;
wherein R 2 comprises an anti-TfR1 antibody comprising a CDR-H1, a CDR-H2, a CDR-H3, a CDR-L1, a CDR-L2, and a CDR-L3 selected from Table 2,
wherein each instance of the group enclosed by square brackets in formula (Id) is covalently linked to a different amino acid residue of the anti-TfR1 antibody; and wherein n1 is an integer of one or greater representing the number of instances of the group enclosed by square brackets in formula (Id).
5 . The complex of any one of claims 1 to 4 , wherein the anti-TfR1 antibody is a Fab fragment, a full-length IgG, a Fab′ fragment, or a F(ab′) 2 fragment.
6 . The composition of any one of claims 1 to 5 , wherein the anti-TfR1 antibody is a Fab fragment.
7 . The complex of any one of claims 1 to 6 , wherein the anti-TfR1 antibody comprises a VH comprising the amino acid sequence of SEQ ID NO: 17 and a VL comprising the amino acid sequence of SEQ ID NO: 18.
8 . The complex of any one of claims 1 to 7 , wherein the anti-TfR1 antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and a light chain comprising the amino acid sequence of SEQ ID NO: 20.
9 . The complex of any one of claims 1 to 8 , wherein each instance of R 1 is covalently linked to a different lysine residue of the anti-TfR1 antibody.
10 . The complex of any one of claims 1 to 9 , wherein the different amino acid residues comprise K188 and K190 of the light chain constant region based on Kabat numbering.
11 . The complex of any one of claims 1 to 10 , wherein the different amino acid residues are represented by lysine (K) residues in a sequence motif DYEKHKVYA (SEQ ID NO: 27) of the light chain constant region of the anti-TfR1 antibody.
12 . A composition comprising the complex of any one of claims 1 to 11 , optionally wherein the composition is in the form of an aqueous solution.
13 . The composition of claim 12 , wherein the anti-TfR1 antibodies of the complexes in the composition comprise light chain constant regions, and wherein at least 80% of the light chain constant regions of the anti-TfR1 antibodies of the complexes in the composition are independently covalently linked to an oligonucleotide at a linkage site represented by K188 (based on Kabat numbering) and/or a linkage site represented by K190 (based on Kabat numbering) of the light chain constant region of each anti-TfR1 antibody.
14 . The composition of claim 12 , wherein the anti-TfR1 antibodies of the complexes in the composition comprise light chain constant regions, and wherein at least 80% of light chain constant regions of the anti-TfR1 antibodies of the complexes in the composition are independently covalently linked to an oligonucleotide at linkage sites represented by lysine (K) residues in a sequence motif DYEKHKVYA (SEQ ID NO: 27) of the light chain constant region of each antibody.
15 . A method of promoting expression or activity of a dystrophin protein in a subject, the method comprising administering to the subject the complex of any one of claims 1 to 11 or the composition of any one of claims 12 to 14 .
16 . The method of claim 15 , wherein the dystrophin protein is a truncated dystrophin protein.
17 . A method of treating a subject having a mutated DMD allele associated with Duchenne Muscular Dystrophy, the method comprising administering to the subject the complex of any one of claims 1 to 11 or the composition of any one of claims 12 to 14 .
18 . The method of claim 17 , wherein the complex promotes expression or activity of a dystrophin protein in the subject.
19 . The method of claim 18 , wherein the dystrophin protein is a truncated dystrophin protein.
20 . The method of any one of claims 17 to 19 , wherein the mutated DMD allele comprises a mutation amenable to exon 45 skipping.
21 . The method of any one of claims 17 to 20 , wherein the mutated DMD allele comprises a frameshift mutation in exon 45.