RNAi Agents for Inhibiting Expression of Complement Component C3 (C3), Pharmaceutical Compositions Thereof, and Methods of Use
The present disclosure relates to RNAi agents, e.g., double stranded RNAi agents or siRNAs, able to inhibit Complement Component C3 (C3) gene expression. Also disclosed are pharmaceutical compositions that include C3 RNAi agents and methods of use thereof. The C3 RNAi agents disclosed herein may be conjugated to targeting ligands, including ligands that comprise N-acetyl-galactosamine, to facilitate the delivery to hepatocyte cells. Delivery of the C3 RNAi agents in vivo provides for inhibition of C3 gene expression. The RNAi agents can be used in methods of treatment of diseases, disorders, or symptoms mediated in part by C3 gene expression, including IgA nephropathy, C3 glomerulopathy, paroxysmal nocturnal hemoglobinuria, and/or other complement-mediated renal diseases.
1 .- 18 . (canceled)
19 . An RNAi for inhibiting expression of a C3-related gene, comprising:
an antisense strand and a sense strand,
wherein the antisense strand comprises the nucleotide sequence (5′→3′)
(SEQ ID NO: 3)
UUUCGAACAACAGAGUAGGGU,
wherein the sense strand comprises the nucleotide sequence (5′→3′)
(SEQ ID NO: 8)
ACCCUACUCUGUUGUUCGAAA,
wherein the antisense strand comprises (i) at least one phosphorothioate linkage at its 5′ end, (ii) at least one phosphorothioate linkage at its 3′ end, (iii) at least 8 nucleotides selected from 2′-fluoro adenosine, 2′-fluoro cytidine, 2′-fluoro guanosine, and 2′-fluoro uridine, and (iv) at least 13 nucleotides selected from 2′-O-methyl adenosine, 2′-O-methyl cytidine, 2′-O-methyl guanosine, and 2′-O-methyl uridine, and
wherein the RNAi agent is linked to a targeting ligand that comprises N-acetyl-galactosamine.
20 . The RNAi agent of claim 19 , wherein the targeting ligand comprises:
21 . The RNAi agent of claim 19 , wherein the targeting ligand is linked to the sense strand.
22 . The RNAi agent of claim 21 , wherein the targeting ligand is linked to the 5′ terminal end of the sense strand.
23 . The RNAi agent of claim 19 , wherein the sense strand is between 21 and 30 nucleotides in length, and the antisense strand is between 21 and 30 nucleotides in length.
24 . The RNAi agent of claim 23 , wherein the sense strand and the antisense strand are each between 21 and 27 nucleotides in length.
25 . The RNAi agent of claim 24 , wherein the sense strand and the antisense strand are each between 21 and 24 nucleotides in length.
26 . The RNAi agent of claim 19 , wherein the sense strand comprises one or two terminal caps.
27 . The RNAi agent of claim 19 , wherein the sense strand comprises one or two inverted abasic residues.
28 . The RNAi agent of claim 19 , wherein the antisense strand comprises the nucleotide sequence (5′→3′) usUfsusCfgAfacaacAfgAfgUfaGfGfgsu (SEQ ID NO: 13), wherein a represents 2′-O-methyl adenosine, c represents 2′-O-methyl cytidine, g represents 2′-O-methyl guanosine, u represents 2′-O-methyl uridine; Af represents 2′-fluoro adenosine, Cf represents 2′-fluoro cytidine, Gf represents 2′-fluoro guanosine, Uf represents 2′-fluoro uridine; and s represents a phosphorothioate linkage.
29 . The RNAi agent of claim 19 , wherein the sense strand comprises the nucleotide sequence (5′→3′)
(NAG37)s(invAb)sacccuacuCfUfGfuuguucgaaas(invAb) (SEQ ID NO: 14), wherein a represents 2′-O-methyl adenosine, c represents 2′-O-methyl cytidine, g represents 2′-O-methyl guanosine, u represents 2′-O-methyl uridine; Cf represents 2′-fluoro cytidine, Gf represents 2′-fluoro guanosine, Uf represents 2′-fluoro uridine; s represents a phosphorothioate linkage; (invAb) is an inverted abasic deoxyribose residue; and
(NAG37)s comprises the following chemical structure:
30 . The RNAi agent of claim 19 , wherein the antisense strand comprises the nucleotide sequence (5′→3′) usUfsusCfgAfacaacAfgAfgUfaGfGfgsu (SEQ ID NO: 13) and wherein the sense strand comprises the nucleotide sequence (5′→3′) (NAG37)s(invAb)sacccuacuCfUfGfuuguucgaaas(invAb) (SEQ ID NO: 14), wherein a represents 2′-O-methyl adenosine, c represents 2′-O-methyl cytidine, g represents 2′-O-methyl guanosine, u represents 2′-O-methyl uridine; Af represents 2′-fluoro adenosine, Cf represents 2′-fluoro cytidine, Gf represents 2′-fluoro guanosine, Uf represents 2′-fluoro uridine; s represents a phosphorothioate linkage; (invAb) is an inverted abasic deoxyribose residue; and (NAG37)s comprises the following chemical structure:
31 . The RNAi agent of claim 19 , wherein the RNAi agent is a pharmaceutically acceptable salt.
32 . The RNAi agent of claim 31 , wherein the RNAi agent is a sodium salt.
33 . A composition comprising the RNAi agent of claim 19 , wherein the composition comprises a pharmaceutically acceptable excipient.
34 . The composition of claim 33 , wherein the pharmaceutically acceptable excipient is a sodium phosphate buffer.
35 . The composition of claim 33 , wherein the pharmaceutically acceptable excipient is isotonic saline or water for injection.
36 . A method for inhibiting expression of a C3 gene in a subject, the method comprising administering to the subject an effective amount of the composition of claim 33 .
37 . The method of claim 36 , wherein the disease is IgA nephropathy (IgAN), C3 glomerulopathy (C3G), paroxysmal nocturnal hemoglobinuria (PNH), lupus nephritis, primary membranous nephropathy (PMN), autoimmune hemolytic anemia/cold agglutinin disease (AIHA/CAD), and/or another type of complement-mediated renal disease.
38 . The method of claim 37 , wherein the level of serum C3 protein is decreased in the subject.