IP Library Patent Application 19234757
Patent Application
App. No. 19/234,757

ANTI-C9ORF72 OLIGONUCLEOTIDES AND RELATED METHODS

Loading inventors, assignments & file history…
Monitor This Case
Get email alerts when status or documents change.
Order Certified Copies
Most orders are placed with the USPTO same day — all within 24 business hours.
Order via The Patent Place →
Pre-filled with this patent's details
Quick Facts
Patent No.
US None
App. No.
19/234,757
Abstract

The present disclosure provides antisense compounds, methods, and compositions for silencing C9ORF72 transcripts. The present disclosure provides antisense compounds, methods, and compositions for the treatment, prevention, or amelioration of diseases, disorders, and conditions associated with C9ORF72 in a subject in need thereof. Also contemplated are antisense compounds and methods for the preparation of a medicament for the treatment, prevention, or amelioration of a disease, disorder, or condition associated with C9ORF72.

Claims (30)

1 - 88 . (canceled)

89 . A method for inhibiting expression of a chromosome 9 open reading frame 72 (C9ORF72) gene in a cell, the method comprising:

(a) introducing into the cell an antisense oligonucleotide; and

(b) maintaining the cell produced in step (a) for a time sufficient to obtain degradation of transcripts of the C9ORF72 gene, thereby inhibiting expression of the C9ORF72 gene in the cell,

wherein the antisense oligonucleotide comprises a region of complementarity to a C9ORF72 antisense transcript sequence of 5′ GAAAGUAAAAAUGCGUCGAG 3′ (SEQ ID NO: 1), 5′ CUCCUUGUUUUCUUCUGGUU 3′ (SEQ ID NO: 2), 5′ CAGGUCUUUUCUUGUUCACC 3′ (SEQ ID NO: 3), or 5′ CCUCCUUGUUUUCUUCUGGU 3′ (SEQ ID NO: 4).

90 . A method of treating or managing Amyotrophic Lateral Sclerosis (ALS) comprising administering to a patient in need of such treatment or management a therapeutically effective amount of an antisense oligonucleotide, wherein the antisense oligonucleotide comprises a region of complementarity to a chromosome 9 open reading frame 72 (C9ORF72) antisense transcript sequence of 5′ GAAAGUAAAAAUGCGUCGAG 3′ (SEQ ID NO:1), 5′ CUCCUUGUUUUCUUCUGGUU 3′ (SEQ ID NO: 2), 5′ CAGGUCUUUUCUUGUUCACC 3′ (SEQ ID NO: 3), or 5′ CCUCCUUGUUUUCUUCUGGU 3′ (SEQ ID NO: 4).

91 . The method of claim 90 , wherein the antisense oligonucleotide is administered to the brain of the patient.

92 . The method of claim 90 , wherein the antisense oligonucleotide is administered by intrathecal, intraventricular, or intrastriatal injection, or infusion.

93 . The method of claim 92 , wherein the injection or infusion comprises administration using an Ommaya reservoir or intrathecal catheter.

94 . The method of claim 89 , wherein the antisense oligonucleotides are administered sequentially.

95 . (canceled)

96 . A method of reducing the level of a dipeptide repeat protein in a patient in need of such reduction, the method comprises administering to the patient a therapeutically effective amount of an antisense oligonucleotide, wherein the antisense oligonucleotide comprises a region of complementarity to a chromosome 9 open reading frame 72 (C9ORF72) antisense transcript sequence of 5′ GAAAGUAAAAAUGCGUCGAG 3′ (SEQ ID NO:1), 5′ CUCCUUGUUUUCUUCUGGUU 3′ (SEQ ID NO: 2), 5′ CAGGUCUUUUCUUGUUCACC 3′ (SEQ ID NO: 3), or 5′ CCUCCUUGUUUUCUUCUGGU 3′ (SEQ ID NO: 4).

97 . The method of claim 96 , wherein the antisense oligonucleotide is administered to the brain of the patient.

98 . The method of claim 96 , wherein the antisense oligonucleotide is administered by intrathecal, intraventricular, or intrastriatal injection, or infusion.

99 . The method of claim 98 , wherein the injection or infusion comprises administration using an Ommaya reservoir or intrathecal catheter.

100 . The method of claim 96 , wherein the dipeptide repeat protein comprises one or more of poly(GP), poly(GR), poly(GA), poly(PA), and poly(PR).

101 . The method of claim 96 , wherein the dipeptide repeat protein is poly(GP).

102 . The method of claim 89 , wherein the antisense oligonucleotide comprises 8 to 80nucleotides in length.

103 . The method of claim 89 , wherein the antisense oligonucleotide comprises one or more modified nucleotides.

104 . The method of claim 103 , wherein the one or more modified nucleotides each independently comprise a modification of a ribose group, a phosphate group, a nucleobase, or a combination thereof.

105 . The method of claim 104 , wherein each modification of the ribose group is 2′-O-methyl, 2′-fluoro, 2′-H, 2′-O-(2-methoxyethyl) (MOE), a 2′-O-alkyl, a 2′-O-alkoxy, a 2′-O-alkylamino, 2′-NH 2 , or a constrained nucleotide.

106 . The method of claim 105 , wherein the constrained nucleotide is a locked nucleic acid (LNA), an ethyl-constrained nucleotide, a 2′-(S)-constrained ethyl (S-cEt) nucleotide, a constrained MOE, a 2′-O,4′-C-aminomethylene bridged nucleic acid (2′,4′-BNA NC ), an alpha-L-locked nucleic acid, a tricyclo-DNA, or any combination thereof.

107 . The method of claim 104 , wherein each modification of the phosphate group is aphosphorothioate, phosphonoacetate (PACE), thiophosphonoacetate (thioPACE), amide, triazole, phosphonate, or phosphotriester modification.

108 . The method of claim 104 , wherein each modification of the nucleobase group is 2-thiouridine, 4-thiouridine, N 6 -methyladenosine, pseudouridine, 2,6-diaminopurine, inosine, thymidine, 5-methylcytosine, 5-substituted pyrimidine, isoguanine, isocytosine, or a halogenated aromatic group.

109 . The method of claim 89 , wherein the antisense oligonucleotide comprises the formula:

A-B-C, wherein:

A comprises from about 0 to about 8 modified nucleotides;

B comprises from about 4 to about 18 deoxyribonucleic acid (DNA) nucleotides and/or DNA-like nucleotides; and

C comprises from about 0 to about 8 modified nucleotides;

and wherein the overall length of the antisense oligonucleotide is about 10 to about 30 nucleotides.

Assignments (1)
ASSIGNMENT OF ASSIGNOR'S INTEREST Recorded Jun 11, 2025
From: BROWN, ROBERT H., JR.; WATTS, JONATHAN K.; TRAN, HELENE; MOAZAMI, MICHAEL
To: UNIVERSITY OF MASSACHUSETTS
Reel/Frame 071386/0430 →