RNAi Agents for Inhibiting Expression of Thymic Stromal Lymphopoietin (TSLP), Compositions Thereof, and Methods of Use
Described are RNAi agents, compositions that include RNAi agents, and methods for inhibition of a thymic stromal lymphopoietin (TSLP) gene. The TSLP RNAi agents and RNAi agent conjugates disclosed herein inhibit the expression of an TSLP gene. Pharmaceutical compositions that include one or more TSLP RNAi agents, optionally with one or more additional therapeutics, are also described. Delivery of the described TSLP RNAi agents to pulmonary cells, in vivo, provides for inhibition of TSLP gene expression, which can provide a therapeutic benefit to subjects, including human subjects, for the treatment of various diseases including pulmonary inflammation diseases such as asthma, including allergic asthma.
1 . An RNAi agent for inhibiting expression of a thymic stromal lymphopoietin gene, comprising:
an antisense strand comprising at least 17 contiguous nucleotides differing by 0 or 1 nucleotides from any one of the sequences provided in Table 2 or Table 3; and
a sense strand comprising a nucleotide sequence that is at least partially complementary to the antisense strand.
2 . The RNAi agent of claim 1 , wherein the antisense strand comprises nucleotides 2-18 of any one of the sequences provided in Table 2 or Table 3.
3 . The RNAi agent of claim 1 or claim 2 , wherein the sense strand comprises a nucleotide sequence of at least 17 contiguous nucleotides differing by 0 or 1 nucleotides from any one of the sequences provided in Table 2 or Table 4, and wherein the sense strand has a region of at least 85% complementarity over the 17 contiguous nucleotides to the antisense strand.
4 . The RNAi agent of any one of claims 1-3 , wherein at least one nucleotide of the TSLP RNAi agent is a modified nucleotide or includes a modified internucleoside linkage.
5 . The RNAi agent of any one of claims 1-4 , wherein all or substantially all of the nucleotides are modified nucleotides.
6 . The RNAi agent of any one of claims 4-5 , wherein the modified nucleotide is selected from the group consisting of: 2′-O-methyl nucleotide, 2′-fluoro nucleotide, 2′-deoxy nucleotide, 2′,3′-seco nucleotide mimic, locked nucleotide, 2′-F-arabino nucleotide, 2′-methoxyethyl nucleotide, abasic nucleotide, ribitol, inverted nucleotide, inverted 2′-O-methyl nucleotide, inverted 2′-deoxy nucleotide, 2′-amino-modified nucleotide, 2′-alkyl-modified nucleotide, morpholino nucleotide, vinyl phosphonate-containing nucleotide, cyclopropyl phosphonate-containing nucleotide, and 3′-O-methyl nucleotide.
7 . The RNAi agent of claim 5 , wherein all or substantially all of the nucleotides are modified with 2′-O-methyl nucleotides, 2′-fluoro nucleotides, or combinations thereof.
8 . The RNAi agent of any one of claims 1-7 , wherein the antisense strand comprises the nucleotide sequence of any one of the modified sequences provided in Table 3.
9 . The RNAi agent of any one of claims 1-8 , wherein the sense strand comprises the nucleotide sequence of any one of the modified sequences provided in Table 4.
10 . The RNAi agent of claim 1 , wherein the antisense strand comprises the nucleotide sequence of any one of the modified sequences provided in Table 3 and the sense strand comprises the nucleotide sequence of any one of the modified sequences provided in Table 4.
11 . The RNAi agent of any one of claims 1-10 , wherein the sense strand is between 18 and 30 nucleotides in length, and the antisense strand is between 18 and 30 nucleotides in length.
12 . The RNAi agent of claim 11 , wherein the sense strand and the antisense strand are each between 18 and 27 nucleotides in length.
13 . The RNAi agent of claim 12 , wherein the sense strand and the antisense strand are each between 18 and 24 nucleotides in length.
14 . The RNAi agent of claim 13 , wherein the sense strand and the antisense strand are each 21 nucleotides in length.
15 . The RNAi agent of claim 14 , wherein the RNAi agent has two blunt ends.
16 . The RNAi agent of any one of claims 1-15 , wherein the sense strand comprises one or two terminal caps.
17 . The RNAi agent of any one of claims 1-16 , wherein the sense strand comprises one or two inverted abasic residues.
18 . The RNAi agent of claim 1 , wherein the RNAi agent is comprised of a sense strand and an antisense strand that form a duplex having the structure of any one of the duplexes in Table 7A, Table 7B, Table 8, Table 9, or Table 10.
19 . The RNAi agent of claim 18 , wherein all or substantially all of the nucleotides are modified nucleotides.
20 . The RNAi agent of claim 1 , comprising an antisense strand that consists of, consists essentially of, or comprises a nucleotide sequence that differs by 0 or 1 nucleotides from one of the following nucleotide sequences (5′→3′):
(SEQ ID NO: 836)
AGACAUUUAUUGGUUGUGACC;
(SEQ ID NO: 853)
AGACGUUUAUUGGUUGUGACC;
(SEQ ID NO: 837)
UGACAUUUAUUGGUUGUGACC;
(SEQ ID NO: 856)
UGACGUUUAUUGGUUGUGACC;
(SEQ ID NO: 196)
AGACAUUUAUUGGUUGUGA;
(SEQ ID NO: 197)
UGACAUUUAUUGGUUGUGA;
(SEQ ID NO: 137)
UUAGCAUUUAUCUGAGUUU;
(SEQ ID NO: 139)
UUAGCAUUUAUCUGAGUUC;
(SEQ ID NO: 192)
UACAUUUAUUGGUUGUGAC;
(SEQ ID NO: 830)
AGACAUUUAUUGGUUGUGACU;
(SEQ ID NO: 825)
UUAGCAUUUAUCUGAGUUUCC;
or
(SEQ ID NO: 826)
UACAUUUAUUGGUUGUGACUU.
21 . The RNAi agent of claim 20 , wherein the sense strand consists of, consists essentially of, or comprises a nucleotide sequence that differs by 0 or 1 nucleotides from one of the following nucleotide sequences (5′→3′):
(SEQ ID NO: 872)
GGUCACAACCAAUAAAUGUCU;
(SEQ ID NO: 873)
GGUCACAACCAAUAAAUGUCA;
(SEQ ID NO: 461)
UCACAACCAAUAAAUGUCU;
(SEQ ID NO: 462)
UCACAACCAAUAAAUGUCA;
(SEQ ID NO: 402)
AAACUCAGAUAAAUGCUAA;
(SEQ ID NO: 871)
G(A 2N )ACUCAGAUAAAUGCUAA;
(SEQ ID NO: 457)
GUCACAACCAAUAAAUGUA
(SEQ ID NO: 864)
AGUCACAACCAAUAAAUGUCU;
(SEQ ID NO: 866)
GGAAACUCAGAUAAAUGCUAA;
or
(SEQ ID NO: 863)
(A 2N )AGUCACAACCAAUAAAUGUA,
wherein (A 2N ) represents a 2-aminoadenosine nucleotide.
22 . The RNAi agent of claim 20 or 21 , wherein all or substantially all of the nucleotides are modified nucleotides.
23 . The RNAi agent of claim 1 , comprising an antisense strand that comprises, consists of, or consists essentially of a modified nucleotide sequence that differs by 0 or 1 nucleotides from one of the following nucleotide sequences (5′→3′):
(SEQ ID NO: 649)
cPrpasGfsacauuuaUfuGfgUfuGfugacsc
(SEQ ID NO: 609)
cPrpasGfsaCfaUfuUfaUfuGfgUfuGfuGfaCfsu;
(SEQ ID NO: 611)
cPrpasGfsacauuuaUfuGfgUfuGfugacsu;
(SEQ ID NO: 681)
cPrpasGfsacguuuaUfuGfgUfuGfugacsc;
(SEQ ID NO: 612)
cPrpasGfsacauuuAfuuGfgUfuGfugacsu;
(SEQ ID NO: 603)
cPrpusUfsagcauuUfauCfuGfaGfuuucsc;
(SEQ ID NO: 606)
cPrpusUfsagcauUfuauCfuGfaGfuuucsc;
or
(SEQ ID NO: 594)
cPrpusAfscsAfuUfuAfuUfgGfuUfgUfgAfcUfsu;
wherein a represents 2′-O-methyl adenosine, c represents 2′-O-methyl cytidine, g represents 2′-O-methyl guanosine, and u represents 2′-O-methyl uridine; Af, represents 2′-fluoro adenosine, Cf represents 2′-fluoro cytidine, Gf represents 2′-fluoro guanosine, and Uf represents 2′-fluoro uridine; cPrpa represents a 5′-cyclopropyl phosphonate-2′-O-methyl adenosine; cPrpu represents a 5′-cyclopropyl phosphonate-2′-O-methyl uridine; s represents a phosphorothioate linkage; and wherein all or substantially all of the nucleotides on the sense strand are modified nucleotides.
24 . The RNAi agent of claim 1 , wherein the sense strand comprises, consists of, or consists essentially of a modified nucleotide sequence that differs by 0 or 1 nucleotides from one of the following nucleotide sequences (5′→3′):
(SEQ ID NO: 714)
gsgucacaaCfCfAfauaaaugucu;
(SEQ ID NO: 702)
asgucacaaCfCfAfauaaaugucu;
(SEQ ID NO: 704)
gsgaaacucAfGfAfuaaaugcuaa;
(SEQ ID NO: 701)
a_2NsagucacaAfCfCfaauaaaugua;
wherein a represents 2′-O-methyl adenosine, c represents 2′-O-methyl cytidine, g represents 2′-O-methyl guanosine, and u represents 2′-O-methyl uridine; Af, represents 2′-fluoro adenosine, Cf represents 2′-fluoro cytidine, Gf represents 2′-fluoro guanosine, and Uf represents 2′-fluoro uridine; a 2N represents 2′-O-methyl-2-aminoadenosine; s represents a phosphorothioate linkage; and wherein all or substantially all of the nucleotides on the antisense strand are modified nucleotides.
25 . The RNAi agent of any one of claims 20-24 , wherein the sense strand further includes inverted abasic residues at the 3′ terminal end of the nucleotide sequence, at the 5′ end of the nucleotide sequence, or at both.
26 . The RNAi agent of any one of claims 1-25 , wherein the RNAi agent is linked to a targeting ligand.
27 . The RNAi agent of claim 26 , wherein the targeting ligand has affinity for a cell receptor expressed on an epithelial cell.
28 . The RNAi agent of claim 27 , wherein the targeting ligand comprises an integrin targeting ligand.
29 . The RNAi agent of claim 28 , wherein the integrin targeting ligand is an αvβ6 integrin targeting ligand.
30 . The RNAi agent of claim 29 , wherein the targeting ligand comprises the structure:
or a pharmaceutically acceptable salt thereof, or
or a pharmaceutically acceptable salt thereof,
wherein indicates the point of connection to the RNAi agent.
31 . The RNAi agent of any one of claims 26-29 , wherein the targeting ligand has a structure selected from the group consisting of:
wherein indicates the point of connection to the RNAi agent.
32 . The RNAi agent of claim 31 , wherein RNAi agent is conjugated to a targeting ligand having the following structure:
33 . The RNAi agent of any one of claims 26-32 , wherein the targeting ligand is conjugated to the sense strand.
34 . The RNAi agent of claim 33 , wherein the targeting ligand is conjugated to the 5′ terminal end of the sense strand.
35 . The RNAi agent of any one of claims 1-34 , wherein the RNAi agent is a pharmaceutically acceptable salt.
36 . The RNAi agent of any one of claim 35 , wherein the RNAi agent is a sodium salt.
37 . A composition comprising the RNAi agent of any one of claims 1-36 , wherein the composition further comprises a pharmaceutically acceptable excipient.
38 . The composition of claim 37 , further comprising a second RNAi agent capable of inhibiting the expression of thymic stromal lymphopoietin gene expression.
39 . The composition of any one of claims 37-38 , further comprising one or more additional therapeutics.
40 . The composition of any one of claims 37-39 , wherein the composition is formulated for administration by inhalation.
41 . The composition of claim 40 , wherein the composition is delivered by a metered-dose inhaler, jet nebulizer, vibrating mesh nebulizer, or soft mist inhaler.
42 . The composition of any of claims 37-41 , wherein the RNAi agent is a sodium salt.
43 . The composition of any of claims 37-42 , wherein the pharmaceutically acceptable excipient is water for injection.
44 . The composition of any of claims 37-42 , wherein the pharmaceutically acceptable excipient is a buffered saline solution.
45 . A method for inhibiting expression of a TSLP gene in a cell, the method comprising introducing into a cell an effective amount of an RNAi agent of any one of claims 1-35 or the composition of any one of claims 37-44 .
46 . The method of claim 45 , wherein the cell is within a subject.
47 . The method of claim 46 , wherein the subject is a human subject.
48 . The method of any one of claims 45-47 , wherein following the administration of the RNAi agent the thymic stromal lymphopoietin gene expression is inhibited by at least about 30%.
49 . A method of treating one or more symptoms or diseases associated with enhanced or elevated TSLP cytokine activity levels, the method comprising administering to a human subject in need thereof a therapeutically effective amount of the composition of any one of claims 37-44 .
50 . The method of claim 49 , wherein the disease is asthma including but not limited to allergic asthma, chronic obstructive pulmonary disease including but not limited to chronic bronchitis and emphysema, pulmonary inflammatory disorders, interstitial lung diseases (ILD), cystic fibrosis, various other types of fibrosis, infectious diseases (for example, SARS-COV-2), acute lung injury (for example, acute respiratory distress syndrome (ARDS)), pulmonary hypertension, various pulmonary cancers, chronic rhinosinutis either with or without nasal polyps, autoimmune disorders including but not limited to systemic sclerosis (SSc), and multiple inflammatory diseases including but not limited to atopic dermatitis, chronic spontaneous urticaria, and eosinophilic esophagitis.
51 . The method of claim 50 , wherein the disease is allergic asthma.
52 . The method of any one of claims 45-51 , wherein the RNAi agent is administered at a deposited dose of about 0.01 mg/kg to about 5.0 mg/kg of body weight of the subject.
53 . The method of any one of claims 45-52 , wherein the RNAi agent is administered at a deposited dose of about 0.03 mg/kg to about 2.0 mg/kg of body weight of the subject.
54 . The method of any of claims 45-53 , wherein the RNAi agent is administered in two or more doses.
55 . Use of the RNAi agent of any one of claims 1-36 , for the treatment of a disease, disorder, or symptom that is mediated at least in part by TSLP cytokine activity and/or TSLP gene expression.
56 . Use of the composition according to any one of claims 37-44 , for the treatment of a disease, disorder, or symptom that is mediated at least in part by thymic stromal lymphopoietin cytokine activity and/or thymic stromal lymphopoietin gene expression.
57 . Use of the composition according to any one of claims 37-44 , for the manufacture of a medicament for treatment of a disease, disorder, or symptom that is mediated at least in part by thymic stromal lymphopoietin cytokine and/or thymic stromal lymphopoietin gene expression.
58 . The use of any one of claims 55-57 , wherein the disease is pulmonary inflammation.
59 . A method of making an RNAi agent of any one of claims 1-36 , comprising annealing a sense strand and an antisense strand to form a double-stranded ribonucleic acid molecule.
60 . The method of claim 59 , wherein the sense strand comprises a targeting ligand.
61 . The method of claim 60 , comprising conjugating a targeting ligand to the sense strand.