IP Library Patent Application 19328832
Patent Application
App. No. 19/328,832

RNAi Agents for Inhibiting Expression of Mitochondrial Amidoxime Reducing Component 1 (MARC1), Pharmaceutical Compositions Thereof, and Methods of Use

Loading inventors, assignments & file history…
Monitor This Case
Get email alerts when status or documents change.
Order Certified Copies
Most orders are placed with the USPTO same day — all within 24 business hours.
Order via The Patent Place →
Pre-filled with this patent's details
Quick Facts
Patent No.
US None
App. No.
19/328,832
Abstract

The present disclosure relates to RNAi agents, e.g., double stranded RNAi agents, able to inhibit mitochondrial amidoxime reducing component 1 (MARC1) gene expression. Also disclosed are pharmaceutical compositions that include MARC1 RNAi agents and methods of use thereof. The MARC1 RNAi agents disclosed herein may be conjugated to targeting ligands, including ligands that comprise N-acetyl-galactosamine, to facilitate the delivery to hepatocyte cells. Delivery of the MARC1 RNAi agents in vivo provides for inhibition of MARC1 gene expression. The RNAi agents can be used in methods of treatment of diseases, disorders, or symptoms mediated in part by MARC1 gene expression, including nonalcoholic steatohepatitis (NASH), nonalcoholic fatty liver disease (NAFLD), alcoholic fatty liver disease, autoimmune hepatitis, hepatic fibrosis, cirrhosis, elevated blood cholesterol levels, hypertriglyceridemia, liver disease, and/or other MARC1-related disease.

Claims (92)

1 . An RNAi agent for inhibiting expression of a MARC1 gene, comprising:

an antisense strand comprising a nucleotide sequence of at least 15 contiguous nucleotides differing by 0 or 1 nucleotides from 15 contiguous nucleotides of any one of the antisense strand sequences of Table 2, Table 3, or Table 6D; and

a sense strand comprising a nucleotide sequence that is at least partially complementary to the antisense strand.

2 . The RNAi agent of claim 1 , wherein the antisense strand comprises nucleotides 2-18 of any one of the sequences provided in Table 2, Table 3, or Table 6D.

3 . The RNAi agent of claim 1 or claim 2 , wherein the sense strand comprises a nucleotide sequence of at least 15 contiguous nucleotides differing by 0 or 1 nucleotides from 15 contiguous nucleotides of any one of the sense strand sequences of Table 2, Table 4, Table 5, or Table 6D, and wherein the sense strand has a region of at least 85% complementarity over at least 15 contiguous nucleotides to the antisense strand.

4 . The RNAi agent of any one of claims 1-3 , wherein at least one nucleotide of the RNAi agent includes a modified internucleoside linkage.

5 . The RNAi agent of any one of claims 1-4 , wherein all or substantially all of the nucleotides are modified nucleotides.

6 . The RNAi agent of any one of claims 4-5 , wherein the modified nucleotides are independently selected from the group consisting of: 2′-O-methyl nucleotide, 2′-fluoro nucleotide, 2′-deoxy nucleotide, 2′,3′-seco nucleotide mimic, locked nucleotide, 2′-F-arabino nucleotide, 2′-methoxyethyl nucleotide, abasic nucleotide, ribitol, inverted nucleotide, inverted 2′-O-methyl nucleotide, inverted 2′-deoxy nucleotide, 2′-amino-modified nucleotide, 2′-alkyl-modified nucleotide, morpholino nucleotide, vinyl phosphonate-containing nucleotide, cyclopropyl phosphonate-containing nucleotide, and 3′-O-methyl nucleotide.

7 . The RNAi agent of claim 5 , wherein all or substantially all of the modified nucleotides are 2′-O-methyl nucleotides, 2′-fluoro nucleotides, or combinations thereof.

8 . The RNAi agent of any one of claims 1-7 , wherein the antisense strand consists of or consists essentially of the nucleotide sequence of any one of the modified antisense strand sequences of Table 3 or Table 6D.

9 . The RNAi agent of any one of claims 1-8 wherein the sense strand consists of, consists essentially of, or comprises the nucleotide sequence of any of the modified sense strand sequences of Table 4, Table 5, or Table 6D.

10 . The RNAi agent of claim 1 , wherein the antisense strand comprises the nucleotide sequence of any one of the modified sequences of Table 3, and the sense strand comprises the nucleotide sequence of any one of the modified sequences of Table 4, Table 5, or Table 6D.

11 . The RNAi agent of any one of claims 1-10 , wherein the sense strand is between 18 and 30 nucleotides in length, and the antisense strand is between 18 and 30 nucleotides in length.

12 . The RNAi agent of claim 11 , wherein the sense strand and the antisense strand are each between 18 and 27 nucleotides in length.

13 . The RNAi agent of claim 12 , wherein the sense strand and the antisense strand are each between 18 and 24 nucleotides in length.

14 . The RNAi agent of claim 13 , wherein the sense strand and the antisense strand are each 21 nucleotides in length.

15 . The RNAi agent of claim 14 , wherein the RNAi agent has two blunt ends.

16 . The RNAi agent of any one of claims 1-15 , wherein the sense strand comprises one or two terminal caps.

17 . The RNAi agent of any one of claims 1-16 , wherein the sense strand comprises one or two inverted abasic residues.

18 . The RNAi agent of claim 1 , wherein the RNAi agent is comprised of a sense strand and an antisense strand that form a duplex having the structure of any one of the duplexes in Table 6A and Table 6B.

19 . The RNAi agent of claim 18 , wherein all or substantially all of the nucleotides are modified nucleotides.

20 . The RNAi agent of claim 1 , comprising an antisense strand that consists of, consists essentially of, or comprises a nucleotide sequence that differs by 0 or 1 nucleotides from one of the following nucleotide sequences (5′→3′):

(SEQ ID NO: 1608)

UGAAAGAACUAUUCCAUAAUC;

(SEQ ID NO: 1657)

ACAGAAUCCUGUCUUGUCGUU;

(SEQ ID NO: 1580)

UCCUUUAAAGGUUUUCAGUAG;

or

(SEQ ID NO: 1659)

UAUUGAAGCAUUGAGACACCG.

21 . The RNAi agent of any one of claims 1-20 , wherein the nucleotides of the antisense strand located at position 2 and position 14 from the 5′-end are 2′-fluoro modified nucleotides.

22 . The RNAi agent of claim 21 , wherein the nucleotide of the antisense strand at position 2 is a 2′-fluoro uridine, and the nucleotide of the antisense strand at position 14 is a 2′-fluoro cytidine, and wherein the antisense strand comprises 3 or 4 phosphorothioate internucleoside linkages.

23 . The RNAi agent of any one of claims 1-22 , wherein the sense strand consists of, consists essentially of, or comprises a nucleotide sequence that differs by 0 or 1 nucleotides from one of the following nucleotide sequences (5′→3′):

(SEQ ID NO: 1734)

GAUUAUGGAAUAGUUCUUUCA;

(SEQ ID NO: 1783)

AACGACAAGACAGGAUUCUGU;

(SEQ ID NO: 1774)

CUACUGAAAACCUUUAAAIGA;

or

(SEQ ID NO: 1784)

CGGUGUCUCAAUGCUUCAAUA

24 . The RNAi agent of any one of claims 20-23 , wherein all or substantially all of the nucleotides are modified nucleotides.

25 . The RNAi agent of claim 1 , comprising an antisense strand that comprises, consists of, or consists essentially of a modified nucleotide sequence that differs by 0 or 1 nucleotides from one of the following nucleotide sequences (5′→3′):

(SEQ ID NO: 1143)

cPrpusGfaaaGfaacuaUfuCfcAfuaausc;

(SEQ ID NO: 1228)

asCfagAfauccugUfcUfuGfucgusu;

(SEQ ID NO: 1229)

isCfagAfauccugUfcUfuGfucgusu;

(SEQ ID NO: 1200)

cPrpusCfscsUfuUfaaaggUfuUfuCfaGfuasg;

or

(SEQ ID NO: 1235)

usAfsusugaAfgcauUfgAfgAfcaccsg,

wherein a represents 2′-O-methyl adenosine, c represents 2′-O-methyl cytidine, g represents 2′-O-methyl guanosine, i represents 2′-O-methyl inosine; and u represents 2′-O-methyl uridine: Af, represents 2′-fluoro adenosine, Cf represents 2′-fluoro cytidine, Gf represents 2′-fluoro guanosine, and Uf represents 2′-fluoro uridine: cPrpu represents a 5′-cyclopropyl phosphonate-2′-O-methyl uridine: s represents a phosphorothioate linkage; and wherein all or substantially all of the nucleotides on the sense strand are modified nucleotides.

26 . The RNAi agent of claim 1 , wherein the sense strand comprises, consists of, or consists essentially of a modified nucleotide sequence that differs by 0 or 1 nucleotides from one of the following nucleotide sequences (5′→3′):

(SEQ ID NO: 1319)

gauuauggAfAfUfaguucuuuca;

(SEQ ID NO: 1376)

aacgacaaGfAfCfaggauucugu;

(SEQ ID NO: 1361)

cuacugaaAfAfCfcuuuaaaiga;

or

(SEQ ID NO: 1377)

cggugucuCfAfAfugcuucaaua,

wherein a represents 2′-O-methyl adenosine, c represents 2′-O-methyl cytidine, g represents 2′-O-methyl guanosine, u represents 2′-O-methyl uridine, and i represents 2′-O-methyl inosine; Af, represents 2′-fluoro adenosine, Cf represents 2′-fluoro cytidine, Gf represents 2′-fluoro guanosine, and Uf represents 2′-fluoro uridine; s represents a phosphorothioate linkage; and wherein all or substantially all of the nucleotides on the antisense strand are modified nucleotides.

27 . The RNAi agent of any one of claims 20-26 , wherein the sense strand further includes inverted abasic residues at the 3′ terminal end of the nucleotide sequence, at the 5′ end of the nucleotide sequence, or at both.

28 . The RNAi agent of any one of claims 1-27 , wherein the RNAi agent is linked to a targeting ligand.

29 . The RNAi agent of any one of claims 1-28 , wherein the sense strand comprises:

30 . The RNAi agent of any one of claims 1-29 , wherein the targeting ligand is linked to the sense strand.

31 . The RNAi agent of claim 30 , wherein the targeting ligand is linked to the 5′ terminal end of the sense strand.

32 . A composition comprising the RNAi agent of any one of claims 1-31 , wherein the composition further comprises a pharmaceutically acceptable excipient.

33 . The composition of claim 32 , further comprising a second RNAi agent capable of inhibiting the expression of a MARC1 gene.

34 . The composition of any one of claims 32-33 , further comprising one or more additional therapeutics.

35 . The composition of any one of claims 32-34 , wherein the composition is formulated for administration.

36 . The composition of claim 35 , wherein the composition is delivered by subcutaneous injection.

37 . The composition of any one of claim 32-36 , wherein the pharmaceutically acceptable excipient is a sodium phosphate buffer.

38 . The composition of any one of claim 32-36 , wherein the pharmaceutically acceptable excipient is isotonic saline or water for injection.

39 . A method for inhibiting expression of a MARC1 gene in a hepatocyte cell, the method comprising introducing into a cell of a subject an effective amount of an RNAi agent of any one of claims 1-31 or the composition of any one of claims 32-38 .

40 . The method of claim 39 , wherein the subject is a human subject.

41 . The method of any one of claims 39-40 , wherein the MARC1 mRNA levels are reduced by at least about 50% in the hepatocyte cell or in the subject.

42 . The method of any one of claims 39-41 , wherein the MARC1 protein levels are reduced by at least about 50% in the hepatocyte cell or in the subject.

43 . A method of treating a MARC1-related disease, disorder, or symptom, the method comprising administering to a human subject in need thereof a therapeutically effective amount of the composition of any one of claims 32-38 .

44 . The method of claim 43 , wherein the disease is nonalcoholic steatohepatitis (NASH), nonalcoholic fatty liver disease (NAFLD), alcoholic fatty liver disease, autoimmune hepatitis, hepatic fibrosis, cirrhosis, elevated blood cholesterol levels, hypertriglyceridemia, liver disease, and/or other MARC1-related disease.

45 . The method of any one of claims 39-44 , wherein the level of serum MARC1 protein is decreased in the subject.

46 . The method of any one of claims 39-45 , wherein the RNAi agent is administered to a human subject at a dose of about 0.05 mg/kg to about 5.0 mg/kg of body weight of the human subject.

47 . Use of the RNAi agent of any one of claims 1-31 or the composition according to any one of claims 32-38 , for the treatment of a disease, disorder, or symptom that is mediated at least in part by a reduction in MARC1 gene expression.

48 . Use according to claim 47 , wherein the disease is nonalcoholic steatohepatitis (NASH), nonalcoholic fatty liver disease (NAFLD), alcoholic fatty liver disease, autoimmune hepatitis, hepatic fibrosis, cirrhosis, elevated blood cholesterol levels, hypertriglyceridemia, liver disease, and/or other MARC1-related disease.

49 . Use of the RNAi agent of any one of claims 1-31 or the composition according to any one of claims 32-38 , for the preparation of a pharmaceutical composition for treating a disease, disorder, or symptom that is mediated at least in part by a reduction in MARC1 gene expression.

50 . Use according to any one of claims 47-49 , wherein the RNAi agent is administered to a human subject at a dose of about 0.05 mg/kg to about 5.0 mg/kg of body weight of the human subject.