IMMUNOSUPPRESSANT-RESISTANT MODIFIED ALLOGENEIC MODIFIED IMMUNE CELLS AND METHODS FOR USE THEREOF
As described below, the present disclosure features modified immune effector cells (e.g., T or NK cells) having increased resistance to inhibition by immunosuppressant agents relative to unmodified immune effector cells, compositions containing the same, and methods for use thereof.
1 . A method for treating a neoplasia in a subject in need thereof, the method comprising: administering to the subject
(i) an immunosuppressant agent; and
(ii) a modified allogeneic immune effector cell comprising a chimeric antigen receptor capable of specifically binding a marker expressed by a neoplastic cell present in the subject, wherein the allogeneic immune effector cell further comprises a base edit in its genome that confers resistance to the immunosuppressant agent relative to an unmodified allogeneic immune effector cell.
2 . The method of claim 1 , wherein the base edit reduces expression or activity of an FK506-binding protein 1A (FKBP1A), nuclear receptor subfamily 3, group C, member 1 (NR3C1), and/or peptidyl-prolyl isomerase A (PPIA) polypeptide relative to an unmodified allogeneic immune effector cell.
3 . The method of claim 1 , wherein the immunosuppressant agent is selected from the group consisting of mTOR inhibitors, calcineurin inhibitors, and glucocorticoids.
4 . The method of claim 1 , further comprising introducing the base edit to the modified allogeneic immune effector cell using a base editor system comprising:
(i) a base editor, or a polynucleotide encoding the base editor, wherein the base editor comprises a programmable DNA binding domain and a deaminase domain; and
(ii) a guide polynucleotide, or a polynucleotide encoding the guide polynucleotide, wherein the guide polynucleotide directs the base editor to effect a nucleobase alteration in a polynucleotide encoding a polypeptide selected from the group consisting of FK506-binding protein 1A (FKBP1A), nuclear receptor subfamily 3, group C, member 1 (NR3C1), and peptidyl-prolyl isomerase A (PPIA).
5 . The method of claim 4 , wherein the deaminase domain is an adenosine deaminase and/or a cytidine deaminase.
6 . The method of claim 5 , wherein the deaminase domain is TadA*8.20 or rAPOBEC1, and/or the base editor is ABE8.20m or rBE4 and the guide polynucleotide comprises at least 10 contiguous nucleotides of a spacer sequence listed in Table 2A.
7 . A method for producing a modified allogeneic immune effector cell having increased resistance to an immunosuppressant agent, the method comprising contacting the cell with:
(i) a base editor, or a polynucleotide encoding the base editor, wherein the base editor comprises a programmable DNA binding domain and a deaminase domain; and
(ii) a guide polynucleotide, or a polynucleotide encoding the guide polynucleotide, wherein the guide polynucleotide directs the base editor to effect a nucleobase alteration in a polynucleotide encoding a polypeptide selected from the group consisting of FK506-binding protein 1A (FKBP1A), nuclear receptor subfamily 3, group C, member 1 (NR3C1), and peptidyl-prolyl isomerase A (PPIA);
wherein each nucleobase alteration effects a reduction in expression or activity of the encoded polypeptide, thereby increasing resistance of the modified immune effector cell to immunosuppression by an immunosuppressant agent selected from the group consisting of an mTOR inhibitor, calcineurin inhibitor, and glucocorticoid relative to an unmodified allogeneic immune effector cell.
8 . The method of claim 7 , wherein the deaminase domain is TadA*8.20 or rAPOBEC1, and/or the base editor is ABE8.20m or rBE4.
9 . The method of claim 1 , wherein the modified allogeneic immune effector cells further comprise a base edit that reduces expression of one or more polypeptides selected from the group consisting of beta-2-microglobulin (B2M), cluster of differentiation 3-epsilon (CD3e), cluster of differentiation 3-gamma (CD3g), class II major histocompatibility complex transactivator (CIITA), programmed cell death 1 (PD1), and T cell receptor constant region (TRAC) relative to an unmodified allogeneic immune effector cell.
10 . A cell prepared according to the method of claim 7 .
11 . A pharmaceutical composition comprising the cell of claim 10 and a pharmaceutically acceptable excipient.
12 . A base editor system comprising:
(i) a base editor, or a polynucleotide encoding the base editor, wherein the base editor comprises a programmable DNA binding domain and a deaminase domain; and
(ii) a guide polynucleotide, or a polynucleotide encoding the guide polynucleotide, wherein the guide polynucleotide directs the base editor to effect a nucleobase alteration in a polynucleotide encoding a polypeptide selected from the group consisting of FK506-binding protein 1A (FKBP1A), nuclear receptor subfamily 3, group C, member 1 (NR3C1), and peptidyl-prolyl isomerase A (PPIA).
13 . The base editor system of claim 12 , wherein the deaminase domain is TadA*8.20, and/or the base editor is ABE8.20m or rBE4.
14 . A guide polynucleotide comprising a spacer with a sequence comprising at least 10 contiguous nucleotides selected from those sequences listed in Table 2A.
15 . The guide polynucleotide of claim 14 , wherein the guide polynucleotide comprises a scaffold comprising the following nucleotide sequence: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCA CCGAGUCGGUGCUUUU (SEQ ID NO: 317; SpCas9 scaffold sequence), or a fragment thereof capable of binding a Cas9 polypeptide.
16 . The guide polynucleotide of claim 15 , wherein the guide polynucleotide comprises a sequence comprising at least 10 contiguous nucleotides from the following sequence:
(SEQ ID NO: 553; TSBTx1538)
CUCACCGUCUCCUGGGGAGA.
17 . A polynucleotide encoding the base editor system of claim 13 .
18 . A vector comprising the polynucleotide of claim 18 .
19 . A cell containing the base editor system of claim 7 .
20 . A pharmaceutical composition comprising the base editor system of claim 7 .
21 . A kit suitable for use in the method of claim 1 .
22 . A method for treating a leukemia or a lymphoma in a subject in need thereof, the method comprising administering to the subject
i) an immunosuppressant agent selected from the group consisting of mTOR inhibitors, calcineurin inhibitors, and glucocorticoids; and
ii) a modified allogeneic chimeric antigen receptor (CAR)-expressing T cell, wherein the CAR is capable of specifically binding a marker expressed by a leukemia or a lymphoma cell in the subject, wherein the modified allogeneic CAR T cell has increased resistance to the immunosuppressant agent relative to an unmodified allogeneic immune effector cell, and wherein the modified CAR T cell has been modified using a base editor system comprising:
(a) a base editor, or a polynucleotide encoding the base editor, wherein the base editor comprises an SpCas9 domain and a TadA*8.20 adenosine deaminase domain or an rAPOBEC1 domain; and
(b) a guide polynucleotide, or a polynucleotide encoding the guide polynucleotide, wherein the guide polynucleotide comprises a nucleotide sequence selected from those listed in Table 2A and directs the base editor to effect a nucleobase alteration in a polynucleotide encoding a polypeptide selected from the group consisting of FK506-binding protein 1A (FKBP1A), nuclear receptor subfamily 3, group C, member 1 (NR3C1), and peptidyl-prolyl isomerase A (PPIA), wherein the nucleobase alteration reduces or eliminates activity or expression of the polypeptide in the cell.