COMPOSITIONS AND METHODS FOR TREATING STARGARDT DISEASE
Compositions and methods for editing a pathogenic ATP-binding cassette, subfamily A, member 4 (ABCA4) polypeptide-encoding gene using an adenosine deaminase base editor to treat a congenital eye disorder, such as Stargardt disease. In various embodiments, the disclosure provides methods for altering a nucleobase (e.g., c.4139T) in an ABCA4 gene codon 1380 encoding a pathogenic leucine so that the codon is altered to encode a proline. In some embodiments, the disclosure provides methods for altering a pathogenic c.5714+5A intronic nucleotide of anABCA4 gene so that the nucleotide becomes c.5714+5G.
1 . A method of editing a c.4139T nucleobase of an ATP-binding cassette, subfamily A, member 4 (ABCA4) polynucleotide in a cell, the method comprising contacting the cell with a base editor system comprising:
(a) a base editor polypeptide comprising a nucleic acid programmable DNA binding protein (napDNAbp) domain and an adenosine deaminase domain, or one or more polynucleotides encoding the base editor, and
(b) one or more guide polynucleotides, or one or more polynucleotides encoding the guide polynucleotides, that target said base editor to effect a deamination of the adenosine (A) complementary to the c.4139T nucleobase, thereby introducing a target c.4139T>C alteration to the ABCA4 polynucleotide.
2 . The method of claim 1 , wherein the adenosine deaminase domain is selected from the group consisting of TadA*7.5, TadA*7.9, TadA*7.10, TadA*8.8, TadA*8.9, TADA*8.13, TadA*8.17, or TadA*8.20.
3 . The method of claim 1 , wherein the guide polynucleotides comprise a spacer comprising at least 10 contiguous nucleotides from one of the following guides: 625, 627, 629, 631, 633, 217, 219, 221, 223, or 225.
4 . The method of claim 1 , wherein the napDNAbp domain comprises a Cas9 polypeptide that recognizes a protospacer adjacent motif (PAM) with a nucleotide sequence that is TGG or GGG.
5 . The method of claim 1 , wherein the 4139T>C conversion rate is at least about 30%.
6 . The method of claim 1 , wherein the T to C conversion rate of T B is about or at least about 5-fold or 10-fold greater than the T to C conversion rate at one or both of T 9/10 or T 2/3 in the following sequence: CAGATCGTGCT 9/10 CCT B GGCT 2/3 AC (SEQ ID NO: 436).
7 . A method of editing a c.5714+5A nucleobase of an ATP-binding cassette, subfamily A, member 4 (ABCA4) polynucleotide in a cell, the method comprising contacting the cell with a base editor system comprising:
(a) a base editor polypeptide comprising a nucleic acid programmable DNA binding protein (napDNAbp) domain and an adenosine deaminase domain, or one or more polynucleotides encoding the base editor, and
(b) one or more guide polynucleotides, or one or more polynucleotides encoding the guide polynucleotides, that target said base editor to effect a deamination of the c.5714+5A nucleobase, thereby introducing a target c.5714+5A>G alteration to the ABCA4 polynucleotide.
8 . The method of claim 7 , wherein the adenosine deaminase domain comprises a TadA*7 or a TadA*8 domain selected from the group consisting of TadA*7.10, TadA*7.9, TadA*8.5, TadA*8.8, TadA*8.13, TadA*8.17, TadA*8.20, and TadA*8.20 comprising a V82T amino acid alteration.
9 . The method of claim 1 , wherein the one or more guide polynucleotides comprise a spacer comprising at least 10 contiguous nucleotides from one of the following guide polynucleotides Guide22, 3991, 3992, and 3993.
10 . The method of claim 7 , wherein the c.5714+5A>G conversion rate is at least about 30%.
11 . The method of claim 1 , wherein the A to G conversion rate of A6 is about or at least about 5-fold or 10-fold greater than the A to G conversion rate at a nucleotide complementary to one or both of A 4 or A 10 in the following sequence: GGTA 4 CA 6 TCCA 10 TGCCAC (SEQ ID NO: 437).
12 . The method of claim 1 , wherein the one or more guide polynucleotides comprise a scaffold comprising the sequence GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGG CACCGAGUCGGUGCUUUU (SEQ ID NO: 317; SpCas9 scaffold sequence), or a fragment thereof capable of binding a Cas9 polypeptide.
13 . A base editor system comprising:
(a) a base editor polypeptide comprising a nucleic acid programmable DNA binding protein (napDNAbp) domain and an adenosine deaminase domain, or one or more polynucleotides encoding the base editor, and
(b) one or more guide polynucleotides, or one or more polynucleotides encoding the one or more guide polynucleotides, that target said base editor to effect a deamination of the adenosine (A) complementary to a c.4139T nucleobase of a ATP-binding cassette, subfamily A, member 4 (ABCA4) polynucleotide.
14 . A base editor system comprising:
(a) a base editor polypeptide comprising a nucleic acid programmable DNA binding protein (napDNAbp) domain and an adenosine deaminase domain, or one or more polynucleotides encoding the base editor, and
(b) one or more guide polynucleotides, or one or more polynucleotides encoding the one or more guide polynucleotides, that target said base editor to effect a deamination of a c.5714+5A nucleobase of a ATP-binding cassette, subfamily A, member 4 (ABCA4) polynucleotide.
15 . A guide polynucleotide comprising a spacer with a sequence comprising at least 10 contiguous nucleotides sequences selected from those sequences listed in Table 1 or Table 2.
16 . A polynucleotide encoding the base editor system of claim 14 .
17 . A vector comprising the polynucleotide of claim 16 .
18 . A pharmaceutical composition comprising the polynucleotide of claim 16 and a pharmaceutically acceptable excipient.
19 . A method of treating Stargardt disease in a subject in need thereof, the method comprising administering to the subject the base editor system of claim 14 or a polynucleotide encoding said base editor system.
20 . The method of claim 19 , wherein the method slows or stabilizes progressive loss of vision in the subject.