COMPOSITIONS AND METHODS FOR TREATING HEMOGLOBINOPATHIES
The present invention features compositions and methods for editing deleterious mutations associated with hemoglobinopathies, such as sickle cell disease (SCD). In particular embodiments, the invention provides methods for correcting mutations in a beta globin polynucleotide using modified adenosine base editors termed “ABE8” having unprecedented levels (e.g., >60-70%) of efficiency.
1 . A base editor system comprising a guide RNA comprising the nucleic acid sequence of SEQ ID NO: 151 and a base editor comprising a nucleic acid programmable DNA binding protein (napDNAbp) domain and an adenosine deaminase domain, wherein the adenosine deaminase domain has at least 95% sequence identity to the amino acid sequence of SEQ ID NO: 2, and wherein the adenosine deaminase domain comprises the alterations Y147R, Q154R, and Y123H referenced to SEQ ID NO: 2, or a polynucleotide encoding the base editor.
2 . The base editor system of claim 1 , wherein the guide RNA comprises the nucleic acid sequence of SEQ ID NO: 176.
3 . The base editor system of claim 2 , wherein the guide RNA comprises the following nucleic acid sequence:
(SEQ ID NO: 176)
mCsmUsmUsGACCAAUAGCCUUGACAGUUUUAGAGCUAGAAAUAGCAAGU
UAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGU
GCUsmUsmUsmU,
wherein “mC” is 2′-O-methylcytidine, “mU” is 2′-O-methyluradine, and “s” indicates a position of a phosphorothioate.
4 . The base editor system of claim 1 , wherein the base editor system comprises a polynucleotide encoding the base editor.
5 . The base editor system of claim 4 , wherein the polynucleotide encoding the base editor comprises mRNA.
6 . The base editor system of claim 1 , wherein the base editor comprises only one adenosine deaminase domain.
7 . The base editor system of claim 1 , wherein the adenosine deaminase domain comprises the amino acid sequence of SEQ ID NO: 2 with the alterations Y147R, Q154R, and Y123H.
8 . The base editor system of claim 1 , wherein the napDNAbp comprises a Streptococcus pyogenes Cas9 (SpCas9) domain.
9 . The base editor system of claim 8 , wherein the SpCas9 domain is a nickase.
10 . The base editor system of claim 9 , wherein the SpCas9 domain comprises a D10A amino acid alteration referenced to SEQ ID NO: 1.
11 . The base editor system of claim 10 , wherein the napDNAbp domain comprises an amino acid sequence with at least 95% identity to SEQ ID NO: 1.
12 . The base editor system of claim 1 , wherein the base editor comprises a linker comprising the amino acid sequence of SEQ ID NO: 53.
13 . The base editor system of claim 1 , wherein the base editor comprises a C-terminal nuclear localization signal (NLS).
14 . The base editor system of claim 12 , wherein the NLS comprises the amino acid sequence
EGADKRTADGSEFESPKKKRKV (positions 1567-1588 of SEQ
ID NO: 7).
15 . The base editor system of claim 1 , wherein the base editor comprises an amino acid sequence with at least 95% identity to SEQ ID NO: 107.
16 . The base editor system of claim 1 , wherein the base editor comprises the amino acid sequence of SEQ ID NO: 107.
17 . A pharmaceutical composition comprising the base editor system of claim 1 and a pharmaceutically acceptable carrier, vehicle, or excipient.
18 . A cell comprising the base editor system of claim 1 .
19 . The cell of claim 18 , wherein the cell is in vitro or ex vivo.
20 . The cell of claim 18 , wherein the cell is from a subject having sickle cell disease.
21 . A kit comprising the base editor system of claim 1 and a container.
22 . A base editor system comprising a guide RNA comprising the following nucleic acid sequence:
(SEQ ID NO: 176)
mCsmUsmUsGACCAAUAGCCUUGACAGUUUUAGAGCUAGAAAUAGCAAGU
UAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGU
GCUsmUsmUsmU,
wherein “mC” is 2′-O-methylcytidine, “mU” is 2′-O-methyluradine, and “s” indicates a position of a phosphorothioate, and a base editor comprising an amino acid sequence with at least 95% identity to SEQ ID NO: 107, or a polynucleotide encoding the base editor.
23 . The base editor system of claim 22 , wherein the base editor comprises the amino acid sequence of SEQ ID NO: 107.
24 . The base editor system of claim 22 , wherein the base editor system comprises mRNA encoding the base editor.
25 . A base editor system comprising a guide RNA comprising the following nucleic acid sequence:
(SEQ ID NO: 176)
mCsmUsmUsGACCAAUAGCCUUGACAGUUUUAGAGCUAGAAAUAGCAAGU
UAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGU
GCUsmUsmUsmU,
wherein “mC” is 2′-O-methylcytidine, “mU” is 2′-O-methyluradine, and “s” indicates a position of a phosphorothioate, and an mRNA encoding a base editor comprising the amino acid sequence of SEQ ID NO: 107.
26 . A pharmaceutical composition comprising a base editor system comprising a guide RNA comprising the following nucleic acid sequence:
(SEQ ID NO: 176)
mCsmUsmUsGACCAAUAGCCUUGACAGUUUUAGAGCUAGAAAUAGCAAGU
UAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGU
GCUsmUsmUsmU,
wherein “mC” is 2′-O-methylcytidine, “mU” is 2′-O-methyluradine, and “s” indicates a position of a phosphorothioate, and mRNA encoding a base editor comprising the amino acid sequence of SEQ ID NO: 107, and a pharmaceutically acceptable carrier, vehicle, or excipient.
27 . A cell comprising the base editor system of claim 25 .
28 . A method for producing a red blood cell, the method comprising introducing into a red blood cell progenitor the base editor system of claim 25 and differentiating the red blood cell progenitor into an erythrocyte.
29 . The method of claim 28 , wherein the red blood cell progenitor is a CD34+ hematopoietic stem cell.
30 . A kit comprising the base editor system of claim 25 and a container.