IP Library › Granted Patent US 12,344,839
Granted Patent B2
US 12,344,839 · App. 17/213,887 · Granted Jul 1, 2025

Dual-acting siRNA based modulation of C9orf72

Inventors: Anastasia Khvorova (Westborough, MA); Bruno Miguel da Cruz Godinho (Worcester, MA); James W. Gilbert (Worcester, MA)
Assignee: UNIVERSITY OF MASSACHUSETTS
C12N15/113C12N2310/11C12N2310/314C12N2310/315C12N2310/321C12N2310/322C12N2310/3233C12N2310/332C12N2310/351C12N2320/30
View Patent ↗
Loading inventors, assignments & file history…
Monitor This Case
Get email alerts when status or documents change.
Order Certified Copies
Most orders are placed with the USPTO same day — all within 24 business hours.
Order via The Patent Place →
Pre-filled with this patent's details
Quick Facts
Patent No.
US 12,344,839
App. No.
17/213,887
Granted
Jul 1, 2025
Kind
B2
Abstract

This disclosure relates to novel C9ORF72 targeting sequences. Novel sense and antisense dual-targeting oligonucleotides for the treatment of neurodegenerative diseases are also provided.

Claims (110)

1. A double-acting RNA silencing agent comprising a first oligonucleotide strand and a second oligonucleotide strand, each strand comprising a 5′ end and a 3′ end, wherein the first strand inhibits expression of a C9ORF72 sense transcript and the second strand inhibits expression of a C9ORF72 antisense transcript, wherein the first and second oligonucleotide strand are substantially complementary to a non-repeat region in the C9ORF72 sense and antisense transcript, respectively;

wherein nucleotides at positions 2-6 and 14 from the 3′ end of the second oligonucleotide strand are 2′-methoxy-ribonucleotides.

2. The double-acting RNA silencing agent of claim 1 , wherein the first strand and the second strand comprise guide strands and wherein the first and second strands forma duplex of 15 to 30 nucleotides in length.

3. The double-acting RNA silencing agent of claim 1 , further comprising a hydrophilic moiety or a hydrophobic moiety.

4. The double-acting RNA silencing agent of claim 1 , wherein:

the first strand comprises a region of complementarity, which is substantially complementary to

(SEQ ID NO: 1)

5′ ACAAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGG

3′,

(SEQ ID NO: 2)

5′ AGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGAA

3′, or 

(SEQ ID NO: 4)

5′ AAGAUUAACCAGAAGAAAAC 3′,

the second strand comprises a region of complementarity, which is substantially complementary to

(SEQ ID NO: 3) 

5′ UCCCUCCUUGUUUUCUUCUGGUUAAUCUUUAUCAGGUCUUUUCUU

3′ or 

(SEQ ID NO: 5)

5′ GUUUUCUUCUGGUUAAUCUA 3′.

5. A double-acting RNA silencing agent comprising a first oligonucleotide strand and a second oligonucleotide strand, each strand comprising a 5′ end and a 3′ end, wherein the first strand inhibits expression of a C9ORF72 sense transcript and the second strand inhibits expression of a C9ORF72 antisense transcript, wherein the first and second oligonucleotide strand are substantially complementary to a non-repeat region in the C9ORF72 sense and antisense transcript, wherein the second strand comprises a region of complementarity, which is substantially complementary to

(SEQ ID NO: 3) 

5′ UCCCUCCUUGUUUUCUUCUGGUUAAUCUUUAUCAGGUCUUUUCUU

3′ or 

(SEQ ID NO: 5)

5′ GUUUUCUUCUGGUUAAUCUA 3′.

6. The double-acting RNA silencing agent of claim 1 , wherein nucleotides at positions 2-4 from the 3′ end of the first oligonucleotide strand are 2′-methoxy-ribonucleotides.

7. The double-acting RNA silencing agent of claim 2 , wherein:

the first strand 5′ end and the second strand 5′ end each comprise a 1 nucleotide to 6 nucleotide single stranded nucleotide overhang, or

the first strand 3′ end and the second strand 3′ end each comprise a 1 nucleotide to 6 nucleotide single stranded nucleotide overhang.

8. A pharmaceutical composition comprising the double-acting RNA silencing agent of claim 1 and a pharmaceutically acceptable carrier.

9. A branched oligonucleotide compound comprising at least two double-acting RNA silencing agents, wherein each double-acting RNA silencing agent comprises:

a first guide strand comprising a 5′ end and a 3′ end, and

a second guide strand comprising a 5′ end and a 3′ end, wherein the at least two double-acting RNA silencing agents are connected to one another by one or more moieties comprising a linker, a spacer, or a branching point,

wherein the first guide strand inhibits expression of a sense mRNA target and the second guide strand inhibits expression of an antisense mRNA target, and

wherein nucleotides at positions 2-6 and 14 from the 3′ end of the second guide strand are 2′-methoxy-ribonucleotides.

10. The branched oligonucleotide compound of claim 9 , wherein each double-acting RNA silencing agent comprises a linker, a spacer, or a branching point, at the 3′ end or at the 5′ end of the first or second guide strand;

optionally wherein each second guide strand comprises the linker, spacer, or branching point at the 3′ end; and

optionally wherein each linker comprises an ethylene glycol chain, an alkyl chain, a peptide, an RNA, a DNA, a phosphate, a phosphonate, a phosphoramidate, an ester, an amide, a triazole, or a combination thereof, and wherein any carbon or oxygen atom of the linker is optionally replaced with a nitrogen atom, bears a hydroxyl substituent, or bears an oxo substituent.

11. The branched oligonucleotide compound of claim 9 , further comprising a hydrophobic moiety or a hydrophilic moiety; and optionally wherein the hydrophobic moiety comprises an alkyl group, an alkenyl group, an aryl group, a vitamin, a vitamin derivative, cholesterol, a cholesterol derivative, a lipophilic amino acid, or a combination thereof.

12. The branched oligonucleotide compound of claim 9 , wherein:

the first guide strand comprises a region of complementarity, which is substantially complementary to

(SEQ ID NO: 1)

5′ ACAAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGG

3′,

(SEQ ID NO: 2)

5′ AGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGAA

3′, or 

(SEQ ID NO: 4)

5′ AAGAUUAACCAGAAGAAAAC 3′,

 or

the second guide strand comprises a region of complementarity, which is substantially complementary to

(SEQ ID NO: 3) 

5′ UCCCUCCUUGUUUUCUUCUGGUUAAUCUUUAUCAGGUCUUUUCUU

3′ or 

(SEQ ID NO: 5)

5′ GUUUUCUUCUGGUUAAUCUA 3′.

13. A branched oligonucleotide compound comprising at least two double-acting RNA silencing agents, wherein each double-acting RNA silencing agent comprises:

a first guide strand comprising a 5′ end and a 3′ end, and

a second guide strand comprising a 5′ end and a 3′ end, wherein the at least two double-acting RNA silencing agents are connected to one another by one or more moieties comprising a linker, a spacer, or a branching point, and

wherein the second guide strand comprises a region of complementarity, which is substantially complementary to

(SEQ ID NO: 3) 

5′ UCCCUCCUUGUUUUCUUCUGGUUAAUCUUUAUCAGGUCUUUUCUU

3′ or 

(SEQ ID NO: 5)

5′ GUUUUCUUCUGGUUAAUCUA 3′.

14. The branched oligonucleotide compound of claim 9 , wherein at least one of the at least two double-acting RNA silencing agents comprises a modified nucleotide comprising a nucleotide comprising a 5′-phosphorothioate group, a 2′-deoxy-2′-fluoro modified nucleotide, a 2′-deoxy-modified nucleotide, a locked nucleotide, an abasic nucleotide, a 2′-amino-modified nucleotide, a 2′-alkyl-modified nucleotide, a morpholino nucleotide, a phosphoramidate, or a non-natural base comprising nucleotide.

15. The branched oligonucleotide compound of claim 9 , wherein the first guide strand is substantially complementary to the second guide strand and wherein nucleotides at positions 2-4 from the 3′ end of the first oligonucleotide strand are 2′-methoxy-ribonucleotides; and

optionally wherein at least one nucleotide is mismatched between the first guide strand 5′ end and the second guide strand 3′ end, and at least one nucleotide is mismatched between the first strand 3′ end and the second strand 5′ end; or

optionally wherein at least one dual-acting RNA silencing agent comprises at least one single stranded nucleotide overhang.

16. The branched oligonucleotide compound of claim 15 , wherein:

the first guide strand 5′ end and the second guide strand 5′ end each comprise a 1 nucleotide to 6 nucleotide single stranded nucleotide overhang, or

the first guide strand 3′ end and the second guide strand 3′ end each comprise a 1 nucleotide to 6 nucleotide single stranded nucleotide overhang.

17. A pharmaceutical composition comprising the branched oligonucleotide compound of claim 9 and a pharmaceutically acceptable carrier.

18. A double-acting, double stranded (ds) RNA comprising a first guide strand and a second guide strand, each strand comprising a 5′ end and a 3′ end, wherein at least one nucleotide is mismatched between the first strand 5′ end and the second strand 3′ end, and at least one nucleotide is mismatched between the first strand 3′ end and the second strand 5′ end, wherein the first guide strand inhibits expression of a sense mRNA target and the second guide strand inhibits expression of an antisense mRNA target,

wherein nucleotides at positions 2-6 and 14 from the 3′ end of the second guide strand are 2′-methoxy-ribonucleotides.

19. The double-acting dsRNA of claim 18 , wherein the first guide strand 5′ end and the second guide strand 3′ end comprise three nucleotide mismatches and the first guide strand 3′ end and the second guide strand 5′ end comprise three nucleotide mismatches; and optionally wherein the dsRNA comprises at least one single stranded nucleotide overhang.

20. The double-acting dsRNA of claim 18 , wherein the double-acting dsRNA comprises a modified nucleotide comprising a nucleotide comprising a 5′-phosphorothioate group, a 2′-deoxy-2′-fluoro modified nucleotide, a 2′-deoxy-modified nucleotide, a locked nucleotide, an abasic nucleotide, a 2′-amino-modified nucleotide, a 2′-alkyl-modified nucleotide, a morpholino nucleotide, a phosphoramidate, or a non-natural base comprising nucleotide.

21. The double-acting dsRNA of claim 18 , wherein:

the first guide strand comprises a region of complementarity, which is substantially complementary to

(SEQ ID NO: 1)

5′ ACAAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGG

3′, or

(SEQ ID NO: 4)

5′ AAGAUUAACCAGAAGAAAAC 3′,

 or

the second guide strand comprises a region of complementarity, which is substantially complementary to

(SEQ ID NO: 3) 

5′ UCCCUCCUUGUUUUCUUCUGGUUAAUCUUUAUCAGGUCUUUUCUU

3′ or 

(SEQ ID NO: 5)

5′ GUUUUCUUCUGGUUAAUCUA 3′.

22. A double-acting, double stranded (ds) RNA comprising a first guide strand and a second guide strand, each strand comprising a 5′ end and a 3′ end, wherein at least one nucleotide is mismatched between the first strand 5′ end and the second strand 3′ end, and at least one nucleotide is mismatched between the first strand 3′ end and second strand 5′ end, wherein the first guide strand inhibits expression of a sense mRNA target and the second guide strand inhibits expression of an antisense mRNA target, wherein the second guide strand comprises a region of complementarity, which is substantially complementary to

(SEQ ID NO: 3) 

5′ UCCCUCCUUGUUUUCUUCUGGUUAAUCUUUAUCAGGUCUUUUCUU

3′ or 

(SEQ ID NO: 5)

5′ GUUUUCUUCUGGUUAAUCUA 3′.

23. The double-acting dsRNA of claim 18 , wherein the first guide strand is substantially complementary to the second guide strand; and optionally wherein at least one nucleotide is mismatched between the first guide strand 5′ end and the second guide strand 3′ end, and at least one nucleotide is mismatched between the first guide strand 3′ end and the second guide strand 5′ end.

24. The double-acting dsRNA of claim 18 , wherein:

the first strand 5′ end and the second strand 5′ end each comprise a 1 nucleotide to 6 nucleotide single stranded nucleotide overhang, or

the first strand 3′ end and the second strand 3′ end each comprise a 1 nucleotide to 6 nucleotide single stranded nucleotide overhang.

25. The double-acting dsRNA of claim 18 , wherein at least one of the sense mRNA target and the antisense mRNA target comprises a disease-associated nucleotide sequence.

26. A pharmaceutical composition comprising the double-acting dsRNA of claim 18 and a pharmaceutically acceptable carrier.

27. The double-acting RNA silencing agent of claim 2 , wherein the first strand and the second strand independently each comprise at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleotides and the strands are fully complementary.

28. The double-acting RNA silencing agent of claim 3 , wherein the hydrophobic moiety comprises an alkyl group, an alkenyl group, an aryl group, a vitamin, a vitamin derivative, cholesterol, a cholesterol derivative, a lipophilic amino acid, or combinations thereof.

29. The double-acting RNA silencing agent of claim 6 , wherein the first oligonucleotide strand and the second oligonucleotide strand are fully modified.

30. The double-acting RNA silencing agent of claim 6 , wherein the first oligonucleotide strand is substantially complementary to the second oligonucleotide strand.

31. The double-acting RNA silencing agent of claim 6 , wherein at least one nucleotide is mismatched between the first strand 5′ end and the second strand 3′ end, and at least one nucleotide is mismatched between the first strand 3′ end and the second strand 5′ end.

32. The double-acting RNA silencing agent of claim 30 further comprising at least one single stranded nucleotide overhang.

Assignments (1)
ASSIGNMENT OF ASSIGNOR'S INTEREST Recorded Jul 28, 2021
From: KHVOROVA, ANASTASIA; GODINHO, BRUNO MIGUEL DA CRUZ; GILBERT, JAMES W.
To: UNIVERSITY OF MASSACHUSETTS
Reel/Frame 057002/0655 →
Continuity (2)
Provisional Application 63000899 · Mar 27, 2020
Related Publication 20210340535A1 · Nov 4, 2021
References Cited (111)
US 4522811A · Eppstein et al. · 1985 [cited by applicant]
US 5328470A · Nabel et al. · 1994 [cited by applicant]
US 5684143A · Gryaznov et al. · 1997 [cited by applicant]
US 5814014A · Elsberry et al. · 1998 [cited by applicant]
US 5858988A · Wang · 1999 [cited by applicant]
US 6093180A · Elsberry · 2000 [cited by applicant]
US 6107094A · Crooke · 2000 [cited by applicant]
US 6168587B1 · Bellhouse et al. · 2001 [cited by applicant]
US 6177403B1 · Stedman · 2001 [cited by applicant]
US 6194389B1 · Johnston et al. · 2001 [cited by applicant]
US 6291438B1 · Wang · 2001 [cited by applicant]
US 6471996B1 · Sokoll et al. · 2002 [cited by applicant]
US 6472375B1 · Hoon et al. · 2002 [cited by applicant]
US 7459547B2 · Zamore et al. · 2008 [cited by applicant]
US 7732593B2 · Zamore et al. · 2010 [cited by applicant]
US 7750144B2 · Zamore et al. · 2010 [cited by applicant]
US 7772203B2 · Zamore et al. · 2010 [cited by applicant]
US 8304530B2 · Zamore et al. · 2012 [cited by applicant]
US 8309704B2 · Zamore et al. · 2012 [cited by applicant]
US 8309705B2 · Zamore et al. · 2012 [cited by applicant]
US 8329892B2 · Zamore et al. · 2012 [cited by applicant]
US 8431544B1 · Agrawal et al. · 2013 [cited by applicant]
US 20050220766A1 · Amalfitano et al. · 2005 [cited by applicant]
US 20060078542A1 · Mah et al. · 2006 [cited by applicant]
US 20070259827A1 · Aronin et al. · 2007 [cited by applicant]
US 20080269149A1 · Bowles et al. · 2008 [cited by applicant]
US 20100186103A1 · Gao et al. · 2010 [cited by applicant]
US 20140296486A1 · Gao et al. · 2014 [cited by applicant]
US 20150259679A1 · Bennett et al. · 2015 [cited by applicant]
US 20160251655A1 · Freier · 2016 [cited by examiner]
US 20160319278A1 · Khvorova · 2016 [cited by examiner]
US 20170233735A1 · Corey et al. · 2017 [cited by applicant]
US 20170312367A1 · Khvorova et al. · 2017 [cited by applicant]
US 20200385737A1 · Khvorova et al. · 2020 [cited by applicant]
US 20230114649A1 · Fishilevich · 2023 [cited by examiner]
CA 3164599A1 · 2021 [cited by applicant]
WO WO2003029459A2 · 2003 [cited by applicant]
WO WO2015054676A2 · 2015 [cited by applicant]
WO WO2016112132A1 · 2016 [cited by applicant]
WO WO2017109757A1 · 2017 [cited by applicant]
WO WO2021119226A1 · 2021 [cited by applicant]
Alisky et al., “Gene therapy for amyotrophic lateral sclerosis and other motor neuron diseases”, Hum Gene Ther., 11(17):2315-2329, doi: 10.1089/104303400750038435, (Nov. 20, 2000). [cited by applicant]
Altschul, et al., “Basic local alignment search tool”, J Mol Biol., 215(3):403-10, doi: 10.1016/S0022-2836(05)80360-2, (Oct. 5, 1990). [cited by applicant]
Altschul, et al., “Gapped BLAST and PSI-BLAST: A New Generation Of Protein Database Search Programs”, Nucleic Acids Research, vol. 25, No. 17, pp. 3389-3402, 1997. [cited by applicant]
Alvarez-Erviti et al., “Delivery of siRNA to the mouse brain by systemic injection of targeted exosomes”, Nat Biotechnol., 29(4):341-345, doi: 10.1038/nbt.1807, (Apr. 2011). [cited by applicant]
Ambros et al., “MicroRNAs and other tiny endogenous RNAs in C. elegans”, Curr Biol, 13, 807-18, doi:10.1016/S0960-9822(03)00287-2, (2003). [cited by applicant]
Atwell et al., “Stable heterodimers from remodeling the domain interface of a homodimer using a phage display library”, J Mol Biol., 270(1):26-35, doi: 10.1006/jmbi.1997.1116, (Jul. 4, 1997). [cited by applicant]
Ausubel et al., “Short Protocols In Molecular Biology”, 4th Ed. John Wiley & Sons, NY, ISBN 0-471-32938-X, (1999). [cited by applicant]
Billy et al., “Specific interference with gene expression induced by long, double-stranded RNA in mouse embryonal teratocarcinoma cell lines”, Proc Natl Acad Sci USA, 98(25): 14428-14233, doi: 10.1073/pnas.261562698. (D… [cited by applicant]
Braasch et al., “RNA Interference in Mammalian Cells by Chemically-Modified RNA”, Biochemistry, 42:7967-7975, (2003). [cited by applicant]
Brummelkamp et al., “A System for Stable Expression of Short Interfering RNAs in Mammalian Cells”, Science, 296, 550-553, (2002). [cited by applicant]
Carter et al., “Handbook of Parvoviruses”, ed., p. Tijsser, CRC Press, 1990, pp. 155-168. [cited by applicant]
Chen et al., “Gene therapy for brain tumors: Regression of experimental gliomas by adenovirus-mediated gene transfer in vivo”, Proc. Natl. Acad. Sci. USA, 91, 3054-3057, (1994). [cited by applicant]
Davidson et al., “A model system for in vivo gene transfer into the central nervous system using an adenoviral vector”, Nat Genet., 3(3):219-23, doi: 10.1038/ng0393-219, (Mar. 1993). [cited by applicant]
Davidson et al., “Recombinant adeno-associated virus type 2, 4, and 5 vectors: Transduction of variant cell types and regions in the mammalian central nervous system”, PNAS, 97(7):3428-3432, doi.org/10.1073/pnas.97.7.34… [cited by applicant]
Doench et al., “siRNAs can function as miRNAs”, Genes Dev., 17(4):438-42, doi: 10.1101/gad.1064703, (Feb. 15, 2003). [cited by applicant]
Eckstein, “Phosphorothioate oligodeoxynucleotides: what is their origin and what is unique about them?”, Antisense Nucleic Acid Drug Dev., 10(2):117-121, (Apr. 2000). [cited by applicant]
Egusquiaguirre et al., “Nanoparticle delivery systems for cancer therapy: advances in clinical and preclinical research”, Clin Transl Oncol., 14(2):83-93, doi: 10.1007/s12094-012-0766-6, (Feb. 2012). [cited by applicant]
El Andaloussi et al., “Exosomes for targeted siRNA delivery across biological barriers”, Adv Drug Deliv Rev., 65(3):391-397, doi: 10.1016/j.addr.2012.08.008, (Mar. 2013). [cited by applicant]
El Andaloussi et al., “Extracellular vesicles: biology and emerging therapeutic opportunities”, Nat Rev Drug Discov., 12(5):347-357, doi: 10.1038/nrd3978, (May 2013). [cited by applicant]
El-Andaloussi et al., “Exosome-mediated delivery of siRNA in vitro and in vivo”, Nat Protoc., 7(12):2112-2126, doi: 10.1038/nprot.2012.131, (2012). [cited by applicant]
Elmen et al., “Locked nucleic acid (LNA) mediated improvements in siRNA stability and functionality”, Nucleic Acids Res., 33(1):439-447, doi: 10.1093/nar/gki193, (Jan. 14, 2005). [cited by applicant]
Fattal et al., “Biodegradable polyalkylcyanoacrylate nanoparticles for the delivery of oligonucleotides”, J Control Release, 53(1-3):137-43, doi: 10.1016/s0168-3659(97)00246-0, (Apr. 30, 1998). [cited by applicant]
Fisher et al., “Transduction with Recombinant Adeno-Associated Virus for Gene Therapy Is Limited by Leading-Strand Synthesis”, J Virol., 70:520 532, (Jan. 1996). [cited by applicant]
Godard et al., “Antisense effects of cholesterol-oligodeoxynucleotide conjugates associated with poly(alkylcyanoacrylate) nanoparticles”, Eur J Biochem., 232(2):404-410, (Sep. 1, 1995). [cited by applicant]
Goodson, in Medical Applications of Controlled Release, vol. 2, pp. 115-138, (1984). [cited by applicant]
Grad et al., “Computational and experimental identification of C. elegans microRNAs”, Mol Cell., May 2003, 11(5):1253-1263, doi: 10.1016/s1097-2765(03)00153-9. [cited by applicant]
Griffiths-Jones, “The microRNA Registry”, Nucleic Acids Res., 32(Database issue): D109-D111, doi: 10.1093/nar/gkh023, (Jan. 1, 2004). [cited by applicant]
Haeusler et al., “The expanding biology of the C9orf72 nucleotide repeat expansion in neurodegenerative disease”, Nature Reviews Neuroscience, vol. 17, pp. 383-395 (2016). [cited by applicant]
Hamajima et al., “Intranasal administration of HIV-DNA vaccine formulated with a polymer, carboxymethylcellulose, augments mucosal antibody production and cell-mediated immune response”, Clin Immunol Immunopathol., 88(2… [cited by applicant]
Hutvagner et al., “A microRNA in a multiple-turnover RNAi enzyme complex”, Science, 297(5589):2056-2060, doi: 10.1126/science.1073827, (Aug. 1, 2002). [cited by applicant]
International Search Report and Written Opinion of PCT/US2021/024379, mailed Jul. 13, 2021. [cited by applicant]
Karlin et al., “Applications and Statistics For Multiple High-Scoring Segments In Molecular Sequences”, Proceedings of the National Academy of Sciences of the USA, vol. 90, pp. 5873-5877, Jun. 1, 1993. [cited by applicant]
Karlin et al., “Methods for assessing the statistical significance of molecular sequence features by using general scoring schemes”, Proc. Natl. Acad. Sci. USA, 87:2264-2268, (Mar. 1990). [cited by applicant]
Kontermann et al., “Antibody Engineering Springer-Verlag”, New York, 790, pp. ISBN 3-540-41354-5, (2001). [cited by applicant]
Lagos-Quintana et al., “Identification of novel genes coding for small expressed RNAs”, Science, 294(5543):853-858, doi: 10.1126/science.1064921, (Oct. 26, 2001). [cited by applicant]
Lagos-Quintana et al., “Identification of tissue-specific microRNAs from mouse”, Curr Biol., 12(9):735-739, doi: 10.1016/s0960-9822(02)00809-6, (Apr. 30, 2002). [cited by applicant]
Lai et al., “Computational identification of DrosophilamicroRNA genes”, Genome Biol., 2003, 4(7):R42. doi: 10.1186/GB-2003-4-7-r42. (Jun. 30, 2003). [cited by applicant]
Lam, et al., “A New Type of Synthetic Peptide Library For Identifying Ligand-Binding Activity”, Nature, vol. 354, pp. 82-84, Nov. 7, 1991. [cited by applicant]
Lambert et al., “Nanoparticulate systems for the delivery of antisense oligonucleotides”, Adv Drug Deliv Rev., 47(1):99-112, doi: 10.1016/s0169-409x(00)00116-2, (Mar. 23, 2001). [cited by applicant]
Lau et al., “An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans”, Science, 294(5543):858-862, doi: 10.1126/science.1065062, (Oct. 26, 2001). [cited by applicant]
Lee et al., “An extensive class of small RNAs in Caenorhabditis elegans”, Science, 294(5543):862-864, doi: 10.1126/science.1065329, (Oct. 26, 2001). [cited by applicant]
Lee et al., “Recent Developments in Nanoparticle-Based siRNA Delivery for Cancer Therapy”, BioMed Research International, vol. Article ID 782041, 10 pages, doi:10.1155/2013/782041, (2013). [cited by applicant]
Lim et al., “The microRNAs of Caenorhabditis elegans”, Genes Dev., Apr. 15, 2003, 17(8):991-1008, doi: 10.1101/gad.1074403. [cited by applicant]
Lim et al., “Vertebrate microRNA genes”, Science, 299(5612): 1540, doi: 10.1126/science.1080372, (Mar. 7, 2003). [cited by applicant]
McCaffrey et al., “Gene Expression: RNA interference in adult mice”, Nature, 418(6893):38-39, doi: 10.1038/418038a, (Jul. 4, 2002). [cited by applicant]
Miyagishi et al., “U6 promoter-driven siRNAs with four uridine 3′ overhangs efficiently suppress targeted gene expression in mammalian cells”, Nat Biotechnol., 20(5):497-500, doi: 10.1038/nbt0502-497, (May 2002). [cited by applicant]
Mourelatos et al., “miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs”, Genes Dev., 16(6): 720-728, (Mar. 15, 2002). [cited by applicant]
Nielsen, et al., “Sequence-selective recognition of DNA by strand displacement with a thymine-substituted polyamide”, Science;254(5037): 1497-1500, doi: 10.1126/science.1962210, (Dec. 6, 1991). [cited by applicant]
O'Rourke et al., “C9orf72 BAC Transgenic Mice Display Typical Pathologic Features of ALS/FTD”, Neuron, vol. 88, No. 5, pp. 892-901, Dec. 2, 2015. [cited by applicant]
Petersen et al., “LNA: a versatile tool for therapeutics and genomics”, Trends Biotechnol., 21(2):74-81, doi: 10.1016/S0167-7799(02)00038-0, (Feb. 2003). [cited by applicant]
Putnam, “Antisense strategies and therapeutic applications”, Am. J. Health Syst. Pharm., 53(2), 151-160, (1996). [cited by applicant]
Reinhart et al., “Small RNAs correspond to centromere heterochromatic repeats”, Science, 297(5588):1831, doi: 10.1126/science.1077183, (Aug. 22, 2002). [cited by applicant]
Rusckowski et al., “Biodistribution and metabolism of a mixed backbone oligonucleotide (GEM 231) following single and multiple dose administration in mice”, Antisense Nucleic Acid Drug Dev., 10(5):333-345, doi: 10.1089/… [cited by applicant]
Sambrook, et al., “Molecular Cloning: A Laboratory Manual”, Chapters 9 and 11, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, 1989. [cited by applicant]
Schwab et al., “An approach for new anticancer drugs: oncogene-targeted antisense DNA”, Ann Oncol., 5 Suppl 4:55-58, doi: 10.1093/annonc/5.suppl_4.s55, (1994). [cited by applicant]
Stein et al., “Systemic and Central Nervous System Correction of Lysosomal Storage in Mucopolysaccharidosis Type VII Mice”, J Virol, 73:3424-3429, (1999). [cited by applicant]
Stein, “Inhibition of Vesivirus infections in mammalian tissue culture with antisense morpholino oligomers”, Antisense Nucleic Acid Drug Dev., 11(5):317-325, doi: 10.1089/108729001753231696, (Oct. 2001). [cited by applicant]
Vorobjev et al. “Nuclease resistance and RNase H sensitivity of oligonucleotides bridged by oligomethylenediol and oligoethylene glycol linkers”, Antisense Nucleic Acid Drug Dev., 11(2):77-85, doi: 10.1089/1087290017501… [cited by applicant]
Wang et al., “Nanoparticle-based delivery system for application of siRNA in vivo”, Curr Drug Metab., 11(2):182-196, doi: 10.2174/138920010791110863, (Feb. 2010). [cited by applicant]
Wright et al., “Identification of Factors that Contribute to Recombinant AAV2 Particle Aggregation and Methods to Prevent Its Occurrence during Vector Purification and Formulation”, Molecular Therapy, 12:171-178, (2005). [cited by applicant]
Xia et al., “siRNA-mediated gene silencing in vitro and in vivo”, Nat Biotechnol., 20(10):1006-1010, doi: 10.1038/nbt739, (Sep. 16, 2002). [cited by applicant]
Yekta et al., “MicroRNA-directed cleavage of HOXB8 mRNA”, Science, 304(5670):594-596, doi: 10.1126/science.1097434, (Apr. 23, 2004). [cited by applicant]
Yuan et al, “Recent advances of siRNA delivery by nanoparticles”, Expert Opinion on Drug Delivery, vol. 8, No. 4, pp. 521-536, (2011). [cited by applicant]
Zeng et al., “Both natural and designed micro RNAs can inhibit the expression of cognate mRNAs when expressed in human cells”, Mol. Cell, 9(6):1327-1333, doi: 10.1016/s1097-2765(02)00541-5, (Jun. 2002). [cited by applicant]
Zeng et al., “Sequence requirements for micro RNA processing and function in human cells”, RNA, 9(1):112-123, doi: 10.1261/rna.2780503, (Jan. 2003). [cited by applicant]
Zhang et al., “Several rAAV vectors efficiently cross the blood-brain barrier and transduce neurons and astrocytes in the neonatal mouse central nervous system”, Mol. Ther., 19(8):1440-1448, doi: 10.1038/mt.2011.98, (Ma… [cited by applicant]
Aviño et al., “Branched RNA: A New Architecture for RNA Interference”, Journal of Nucleic Acids, Mar. 6, 2010, 2011: 1-7. doi: 10.4061/2011/568935. [cited by applicant]
Extended European Search Report for European Patent Application No. 21775632.3, dated May 8, 2025. [cited by applicant]
Hu et al., “Engineering Duplex RNAs for Challenging Targets: Recognition of GGGGCC/CCCCGG Repeats at the ALS/FTD C9orf72 Locus”, Chemistry & Biology, Nov. 12, 2015, 22(11): 1505-1511. [cited by applicant]
Vickers et al., “Efficient reduction of target RNAs by small interfering RNA and RNase H-dependent antisense agents. A comparative analysis”, Journal of Biological Chemistry, Feb. 28, 2003, 278(9): 7108-7118. doi: 10.10… [cited by applicant]