Methods for diagnosis, prediction and treatment of asthma and other inflammatory conditions based on eotaxin coding sequence polymorphism
View Patent ↗Methods and compositions for diagnosing and treating asthma are provided. The methods involve the discovery of a correlation between an eotaxin gene polymorphism and the ocurrence of asthma.
1. A composition comprising an isolated nucleic acid consisting of the wild type normal eotaxin gene sequence as shown in SEQ ID NO: 1, wherein said nucleic acid includes a guanine to adenine substitution 67 base pairs following the ATG initiation codon of the wild type normal eotaxin gene, whereby counting is initiated at the A in that codon.
2. A composition comprising an isolated oligonucleotide consisting of a nucleotide sequence selected from the group consisted of:
AGAAACCACCACCTCTCACG;
(SEQ ID NO: 2)
GAGAATTTGCAGTGAGTCTGT;
(SEQ ID NO: 3)
GGGGCTTACCTGGCCCAAC;
(SEQ ID NO: 4)
GGGGCTTACCTGGCCCAAT;
(SEQ ID NO: 5)
and
TCAAGGAAGGTTCTTAGATCG.
(SEQ ID NO. 6).