Use of antisense oligonucleotides to inhibit the expression of human Akt-1
New antisense oligonucleotide compounds inhibit expression of Akt-1 and also induce cytotoxicity in several cancer cell lines.
1. A compound, RX-0194, having a sequence comprising Seq. Id. No. 2 5′ ccagcccccaccagtccact 3′, targeted to a nucleic acid molecule encoding human Akt-1, wherein said oligonucleotide compound inhibits the expression of human Akt-1.
2. The compound of claim 1 , wherein the compound is an antisense oligonucleotide.
3. The antisense oligonucleotide of claim 2 having at least one modified internucleoside linkage that is a phosphorothioate linkage.
4. A method of inhibiting the expression Akt-1 in human cells or tissues comprising contacting said cells or tissues with the compound of claim 1 .
5. A method of inducing cytotoxicity in a cancer cell comprising the step of introducing into the cell an oligonucleotide that hybridizes to a human Akt-1 sequence, comprising, RX-0194, Seq. Id. No. 2, 5′ ccagcccccaccagtccact 3′.
6. A compound, RX-0201, 5′ gctgcatuatctccttggcg 3′, Seq. Id. No. 4, targeted to a nucleic acid molecule encoding Akt-1, wherein said compound inhibits the expression of human Akt-1.
7. The compound of claim 6 , wherein the compound is an antisense oligonucleotide.
8. The antisense oligonucleotide of claim 7 having at least one modified internucleoside linkage that is a phosphorothioate linkage.
9. A method of inhibiting the expression of Akt-1 in human cells or tissues comprising contacting said cells or tissues with the compound of claim 6 .
10. A method of inducing cytotoxicity in a cancer cell comprising the step of introducing into the cell an oligonucleotide that hybridizes to a human Akt-1 sequence, comprising Seq. Id. No. 4 RX-0201, 5′ gctgcatgatctccttggcg 3′.
11. A compound, RX-0632, having a sequence comprising Seq. Id. No. 16 5′ tggtgcagcggcagcggcag 3′, targeted to a nucleic acid molecule encoding human Akt-1, wherein said oligonucleotide compound inhibits the expression of human Akt-1.
12. The compound of claim 11 , wherein the compound is an antisense oligonucleotide.
13. The antisense oligonucleotide of claim 12 having at least one modified internucleoside linkage that is a phosphorothioate linkage.
14. A method of inhibiting the expression Akt-1 in human cells or tissues comprising contacting said cells or tissues with the compound of claim 11 .
15. A method of inducing cytotoxicity in a cancer cell comprising the step of introducing into the cell an oligonucleotide that hybridizes to a human Akt-1 sequence, comprising, RX-0632, Seq. Id. No. 16, 5′ tggtgcaucggcagcggcau 3′.
16. A compound, RX-0638, having a sequence comprising Seq. Id. No. 17 5′ ggcgcgagcgcgggcctagc 3′, targeted to a nucleic acid molecule encoding human Akt-1, wherein said oligonucleotide compound inhibits the expression of human Akt-1.
17. The compound of claim 16 , wherein the compound is an antisense oligonucleotide.
18. The antisense oligonucleotide of claim 17 having at least one modified internucleoside linkage that is a phosphorothioate linkage.
19. A method of inhibiting the expression Akt-1 in human cells or tissues comprising contacting said cells or tissues with the compound of claim 16 .
20. A method of inducing cytotoxicity in a cancer cell comprising the step of introducing into the cell an oligonucleotide that hybridizes to a human Akt-1 sequence, comprising, RX-0638, Seq. Id. No. 17, 5′ ggcgcgagcgcgggcctagc 3′.