Plasmid maintenance system for antigen delivery
The present invention relates generally to a Plasmid Maintenance System for the stabilization of expression plasmids encoding foreign antigens, and methods for making and using the Plasmid Maintenance System. The invention optimizes the maintenance of expression plasmids at two independent levels by: (1) removing sole dependence on balanced lethal maintenance functions; and (2) incorporating at least one plasmid partition function to prevent random segregation of expression plasmids, thereby enhancing their inheritance and stability. The Plasmid Maintenance System may be employed within a plasmid which has been recombinantly engineered to express a variety of expression products.
1. A method of making a live attenuated bacterial vector vaccine, comprising transforming a bacterial strain with an expression vector, wherein said expression vector comprising a nucleotide sequence encoding:
a restricted-copy-number origin of replication cassette comprising (i) a nucleotide sequence encoding an origin of replication that limits the expression vector to an average plasmid copy number of about 2 to 75 copies per cell, (ii) a first unique restriction enzyme cleavage site located 5′ of the nucleotide sequence encoding the origin of replication, and (iii) a second unique restriction enzyme cleavage site located 3′ of the nucleotide sequence encoding the origin of replication;
at least one post-segregational killing cassette comprising (i) a nucleotide sequence encoding at least one post-segregational killing locus, (ii) a first unique restriction enzyme cleavage site located 5′ of the nucleotide sequence encoding the at least one post-segregational killing locus, and (iii) a second unique restriction enzyme cleavage site located 3′ of the nucleotide sequence encoding the at least one post-segregational killing locus; and
at least one partitioning cassette comprising (i) a nucleotide sequence encoding at least one partitioning function, (ii) a first unique restriction enzyme cleavage site 5′ of the nucleotide sequence encoding the at least one partitioning function, and (iii) a second unique restriction enzyme cleavage site located 3′ of the nucleotide sequence encoding the at least one partitioning function.
2. The method of claim 1 , wherein the restricted-copy-number origin of replication is selected from the group consisting of: oriE1 (nucleotides 1250 to 1936 of SEQ ID NO: 1), ori101 (nucleotides 50 to 2004 of SEQ ID NO: 3), and ori15A (nucleotides 50 to 684 of SEQ ID NO: 2).
3. The method of claim 1 , wherein the average plasmid copy-number falls within the range of about 5 to about 60 copies per cell.
4. The method of claim 1 , wherein the nucleotide sequence encoding the at least one post-segregational killing locus is selected from the group consisting of asd, ssb, phd-doc, kis-kid, and hok-sok.
5. The method of claim 1 , wherein the partitioning function is an active partitioning function.
6. The method of claim 1 , wherein the nucleotide sequence encoding the at least one partitioning function comprises parA.
7. The method of claim 1 , wherein the partitioning function is a passive partitioning function.
8. The method of claim 1 , wherein the nucleotide sequence encoding the at least one partitioning function is the par locus of pSC101.
9. The method of claim 1 , further comprising an expression cassette comprising (i) a nucleotide sequence encoding a promoter, (ii) a first unique restriction enzyme cleavage site located 5′ of the nucleotide sequence encoding the promoter, and (iii) a second unique restriction enzyme cleavage site located 3′ of the nucleotide sequence encoding the promoter.
10. The method of claim 1 , further comprising a selection cassette comprising (i) a nucleotide sequence encoding at least one selectable marker, (ii) a first unique restriction enzyme cleavage site located 5′ of the nucleotide sequence encoding the at least one selectable marker, and (iii) a second unique restriction enzyme cleavage site located 3′ of the nucleotide sequence encoding the at least one selectable marker.
11. The method of claim 1 , wherein the bacterial strain is Salmonella typhi.
12. The method of claim 1 , wherein the bacterial strain is a Salmonella typhi strain.
13. The method of claim 9 , wherein the promoter is an inducible promoter.
14. The method of claim 9 , wherein the expression cassette further comprises a nucleotide sequence encoding an antigen of interest located at the 3′ end of nucleotide sequence encoding the promoter.
15. The method of claim 13 , wherein the promoter is an ompC promoter.
16. The method of claim 15 , wherein the ompC promoter is a polynucleotide fragment from E. coli spanning nucleotides +70 through −389, relative to the transcriptional start site +1, of ompC.
17. The method of claim 15 , wherein the ompC promoter comprises the following sequence: AGATCX 1 X 2 TAAX 3 CATCCACAGGAGGATATCTGATG (SEQ ID NO:36), wherein X 1 is selected from the group consisting of G, C and A; X 2 is an insert having from 1 to 5 nucleotides; and X 3 is selected from the group consisting of A, T, G and C.
18. The method of claim 17 , wherein X 1 is G.
19. The method of claim 17 , wherein X 2 has from 1 to 4 nucleotides.
20. The method of claim 17 , wherein X 2 has 4 nucleotides.
21. The method of claim 17 , wherein X 2 has 4 nucleotides, independently selected from the group consisting of A, T and C.
22. The method of claim 17 , wherein X 2 comprises a nucleotide or nucleotide sequence selected from the group consisting of ATCT; ATC; AT; TCT; CT; TC; A; T; C; and T.
23. The method of claim 17 , wherein X 2 is selected from the group consisting of ATCT; ATC; AT; TCT; CT; TC; A; T; C; and T.
24. The method of claim 17 , wherein X 2 is ATCT.
25. The method of claim 17 , wherein X 3 is A.
26. The method of claim 14 , wherein the antigen of interest is selected from the group consisting of a viral antigen, a bacterial antigen, a cancer antigen, and an auto-immune antigen.
27. The method of claim 14 , wherein the antigen of interest comprises a detoxified Shiga toxin.
28. The method of claim 27 , wherein the antigen of interest comprises a detoxified Shiga toxin 2 antigen selected from the group consisting of a Shiga toxin 2 B subunit pentamer and a genetically detoxified Shiga toxin 2.
29. The method of claim 28 , wherein the gene encoding the detoxified Shiga toxin 2 has modified segments selected from the group consisting of:
(797)-ACA GCA GAC GCG TTA-(811);
(SEQ ID NO: 37)
(902)-CTG AAC CTA GGG CGA (916);
(SEQ ID NO: 38)
(1345)-GAA TTC GCG ACC AGT-(1359)
(SEQ ID NO: 39)
and
(1435)-GAA TCA GAT TCT GGA-(1449).
(SEQ ID NO: 40)
30. The method of claim 10 , wherein the selectable marker is a protein which provides resistance to an antibiotic selected from the group consisting of aminoglycosides, ansamycins, antimycotics, penicillins, cephalosporins, chloramphenicols, linosamides, macrolides, peptolides, and tetracyclines.
31. The method of claim 10 , wherein the nucleotide sequence encoding the selectable marker is selected from the group consisting of tetA, bla, aphA-2, and kan.