IP Library › Granted Patent US 7,901,881
Granted Patent B2
US 7,901,881 · App. 11/547,995 · Granted Mar 8, 2011

Diagnostic tool for diagnosing benign versus malignant thyroid lesions

Assignees: The United States of America as represented by the Department of Health and Human Services; The John Hopkins University
View Patent ↗
Loading inventors, assignments & file history…
Monitor This Case
Get email alerts when status or documents change.
Order Certified Copies
Most orders are placed with the USPTO same day — all within 24 business hours.
Order via The Patent Place →
Pre-filled with this patent's details
Quick Facts
Patent No.
US 7,901,881
App. No.
11/547,995
Granted
Mar 8, 2011
Kind
B2
Abstract

The present invention relates to the use of genes differentially expressed in benign thyroid lesions and malignant thyroid lesions for the diagnosis and staging of thyroid cancer.

Claims (42)

1. A method for classifying a thyroid lesion in a subject as benign or malignant comprising:

a) measuring the expression of differentially expressed thyroid (DET) gene C21orf4, Hs.145049, Hs.296031, KIT, SYNGR2, C11orf8, CDH1, FAM13A1, IMPACT, and KIAA1128, in a test cell population obtained from the thyroid lesion in the subject;

b) comparing the expression of said DET genes in the test cell population to the expression of said DET genes in normal thyroid tissue thereby creating an expression ratio pattern for the test cell population; and

c) using Principal Component Analysis to compare the expression ratio-based pattern in the test cell population to the expression ratio-based pattern of cells from a benign thyroid lesion and cells from a malignant thyroid lesion, thereby classifying the thyroid lesion in the subject as benign or malignant.

2. The method of claim 1 , wherein the expression of said DET genes in normal thyroid tissue is measured in a plurality of cells or is derived from a database.

3. The method of claim 1 , wherein the benign lesion is selected from the group consisting of: a follicular adenoma, hyperplastic nodule, papillary adenoma, thyroiditis nodule and multinodular goiter.

4. The method of claim 1 , wherein the malignant thyroid lesion is selected from the group consisting of: papillary thyroid carcinoma, follicular variant of papillary thyroid carcinoma, follicular carcinoma, Hurthle cell tumor, anaplastic thyroid cancer, medullary thyroid cancer, thyroid lymphoma, poorly differentiated thyroid cancer and thyroid angiosarcoma.

5. The method of claim 1 , wherein the subject is a human.

6. The method of claim 1 , wherein expression of the DET genes are measured by microarray.

7. The method of claim 1 , wherein expression of the DET genes are measured by probing the nucleic acid(s).

8. The method of claim 1 , wherein expression of the DET genes are measured by amplifying the nucleic acid(s).

9. The method of claim 1 , wherein the expression of the DET genes are measured by amplifying the DET nucleic acid(s) and detecting the amplified nucleic acid with a fluorescent probe.

10. The method of claim 9 , wherein C21orf4 nucleic acid is amplified utilizing forward primer GCAATCCTCTTACCTCCGCTTT (SEQ ID NO: 7) and reverse primer GGAATCGGAGACAGAAGAGAGCTT (SEQ ID NO: 8) and wherein the amplified nucleic acid is detected with a probe comprising the nucleic acid sequence CTGGGACCACAGATGTATCCTCCACTCC (SEQ ID NO: 9) linked to a fluorescent label.

11. The method of claim 9 , wherein Hs.145049 nucleic acid is amplified utilizing forward primer GGCTGACTGGCAAAAAGTCTTG (SEQ ID NO: 1) and reverse primer TTGGTTCCCTTAAGTTCTCAGAGTTT (SEQ ID NO: 2) and wherein the amplified nucleic acid is detected with a probe comprising the nucleic acid sequence TGGCCCTGTCACTCCCATGATGC (SEQ ID NO: 3) linked to a fluorescent label.

12. The method of claim 9 , wherein Hs.296031 nucleic acid is amplified utilizing forward primer TGCCAAGGAGCTTTGTTTATAGAA (SEQ ID NO: 19) and reverse primer ATGACGGCATGTACCAACCA (SEQ ID NO: 20) and wherein the amplified nucleic acid is detected with a probe comprising the nucleic acid sequence TTGGTCCCCTCAGTTCTATGCTGTTGTGT (SEQ ID NO: 21) linked to a fluorescent label.

13. The method of claim 9 , wherein KIT nucleic acid is amplified utilizing forward primer GCACCTGCTGAAATGTATGACATAAT (SEQ ID NO: 22) and reverse primer TTTGCTAAGTTGGAGTAAATATGATTGG (SEQ ID NO: 23) and wherein the amplified nucleic acid is detected with a probe comprising the nucleic acid sequence ATTGTTCAGCTAATTGAGAAGCAGATTTCAGAGAGC (SEQ ID NO: 24) linked to a fluorescent label.

14. The method of claim 9 , wherein SYNGR2 nucleic acid is amplified utilizing forward primer GCTGGTGCTCATGGCACTT (SEQ ID NO: 31) and reverse primer CCCTCCCCAGGCTTCCTAA (SEQ ID NO: 32) and wherein the amplified nucleic acid is detected with a probe comprising the nucleic acid sequence AAGGGCTTTGCCTGACAACACCCA (SEQ ID NO: 33) linked to a fluorescent label.

15. The method of claim 9 , wherein C11orf8 nucleic acid is amplified utilizing forward primer CCGGCCCAAGCTCCAT (SEQ ID NO: 13) and reverse primer TTGTGTAACCGTCGGTCATGA (SEQ ID NO: 14) and wherein the amplified nucleic acid is detected with a probe comprising the nucleic acid sequence TGTTTGGTGGAATCCATGAAGGTTATGGC (SEQ ID NO: 15) linked to a fluorescent label.

16. The method of claim 9 , wherein CDH1 nucleic acid is amplified utilizing forward primer TGAGTGTCCCCCGGTATCTTC (SEQ ID NO: 28) and reverse primer CAGCCGCTTTCAGATTTTCAT (SEQ ID NO: 29) and wherein the amplified nucleic acid is detected with a probe comprising the nucleic acid sequence CCTGCCAATCCCGATGAAATTGGAAAT (SEQ ID NO: 30) linked to a fluorescent label.

17. The method of claim 9 , wherein IMPACT nucleic acid is amplified utilizing forward primer ATGGCAGTGCAGTCATCATCTT (SEQ ID NO: 10) and reverse primer GCATTCATACAGCTGCTTACCATCT (SEQ ID NO: 11) and the amplified nucleic acid is detected with a probe comprising the nucleic acid sequence TTTGGTCCCTGCCTAGGACCGGG (SEQ ID NO: 12) linked to a fluorescent label.

18. The method of claim 9 , wherein FAM13A1 nucleic acid is amplified utilizing forward primer TGAAGAATGTCATGGTGGTAGTATCA (SEQ ID NO: 25) and reverse primer ATGACTCCTCAGGTGAATTTGTGTAG (SEQ NO: 26) and wherein the amplified nucleic acid is detected with a probe comprising the nucleic acid sequence CTGGTATGGAGGGATTCTGCTAGGACCAG (SEQ ID NO: 27) linked to a fluorescent label.

19. The method of claim 9 , wherein KIAA1128 nucleic acid is amplified utilizing forward primer GAGAGCGTGATCCCCCTACA (SEQ ID NO: 16) and reverse primer ACCAAGAGTGCACCTCAGTGTCT (SEQ ID NO: 17) and the amplified nucleic acid is detected with a probe comprising the nucleic acid sequence TCACTTCCAAATGTTCCTGTAGCATAAATGGTG (SEQ ID NO: 18) linked to a fluorescent label.

20. A method for classifying a thyroid lesion in a subject as benign or malignant comprising:

a) measuring the expression of differentially expressed thyroid (DET) genes C21orf4, Hs.145049, Hs.296031, KIT, LSM7, and SYNGR2, in a test cell population obtained from the thyroid lesion in the subject;

b) comparing the expression of said DET genes in the test cell population to the expression of said DET genes in normal thyroid tissue thereby creating an expression ratio pattern for the test cell population; and

c) using Principal Component Analysis to compare the expression ratio-based pattern in the test cell population to the expression ratio-based pattern of cells from a benign thyroid lesion and cells from a malignant thyroid lesion, thereby classifying the thyroid lesion in the subject as benign or malignant.

21. The method of claim 20 , wherein the expression of said DET genes in normal thyroid tissue is measured in a plurality of cells or is derived from a database.

22. The method of claim 20 , the benign lesion is selected from the group consisting of: a follicular adenoma, hyperplastic nodule, papillary adenoma, thyroiditis nodule and multinodular goiter.

23. The method of claim 20 , wherein the malignant thyroid lesion is selected from the group consisting of: papillary thyroid carcinoma, follicular variant of papillary thyroid carcinoma, follicular carcinoma, Hurthle cell tumor, anaplastic thyroid cancer, medullary thyroid cancer, thyroid lymphoma, poorly differentiated thyroid cancer and thyroid angio sarcoma.

24. The method of claim 20 , wherein the subject is a human.

25. The method of claim 20 , wherein expression of the DET genes are measured by microarray.

26. The method of claim 20 , wherein expression of the DET genes are measured by probing the nucleic acid(s).

27. The method of claim 20 , wherein expression of the DET genes are measured by amplifying the nucleic acid(s).

28. The method of claim 20 , wherein the expression of the DET genes are measured by amplifying the nucleic acid(s) and detecting the amplified nucleic acid with a fluorescent probe.

29. The method of claim 28 , wherein C21orf4 nucleic acid is amplified utilizing forward primer GCAATCCTCTTACCTCCGCTTT (SEQ ID NO: 7) and reverse primer GGAATCGGAGACAGAAGAGAGCTT (SEQ ID NO: 8) and wherein the amplified nucleic acid is detected with a probe comprising the nucleic acid sequence CTGGGACCACAGATGTATCCTCCACTCC (SEQ ID NO: 9) linked to a fluorescent label.

30. The method of claim 28 , wherein Hs.145049 nucleic acid is amplified utilizing forward primer GGCTGACTGGCAAAAAGTCTTG (SEQ ID NO: 1) and reverse primer TTGGTTCCCTTAAGTTCTCAGAGTTT (SEQ ID NO: 2) and wherein the amplified nucleic acid is detected with a probe comprising the nucleic acid sequence TGGCCCTGTCACTCCCATGATGC (SEQ ID NO: 3) linked to a fluorescent label.

31. The method of claim 28 , wherein Hs.296031 nucleic acid is amplified utilizing forward primer TGCCAAGGAGCTTTGTTTATAGAA (SEQ ID NO: 19) and reverse primer ATGACGGCATGTACCAACCA (SEQ ID NO: 20) and wherein the amplified nucleic acid is detected with a probe comprising the nucleic acid sequence TTGGTCCCCTCAGTTCTATGCTGTTGTGT (SEQ ID NO: 21) linked to a fluorescent label.

32. The method of claim 28 , wherein KIT nucleic acid is amplified utilizing forward primer GCACCTGCTGAAATGTATGACATAAT (SEQ ID NO: 22) and reverse primer TTTGCTAAGTTGGAGTAAATATGATTGG (SEQ ID NO: 23) and wherein the amplified nucleic acid is detected with a probe comprising the nucleic acid sequence ATTGTTCAGCTAATTGAGAAGCAGATTTCAGAGAGC (SEQ ID NO: 24) linked to a fluorescent label.

33. The method of claim 28 , wherein LSM7 nucleic acid is amplified utilizing forward primer GACGATCCGGGTAAAGTTCCA (SEQ ID NO: 34) and reverse primer AGGTTGAGGAGTGGGTCGAA (SEQ ID NO: 35) and wherein the amplified nucleic acid is detected with a probe comprising the nucleic acid sequence AGGCCGCGAAGCCAGTGGAATC (SEQ ID NO: 36) linked to a fluorescent label.

34. The method of claim 28 , wherein SYNGR2 nucleic acid is amplified utilizing forward primer GCTGGTGCTCATGGCACTT (SEQ ID NO: 31) and reverse primer CCCTCCCCAGGCTTCCTAA (SEQ ID NO: 32) and wherein the amplified nucleic acid is detected with a probe comprising the nucleic acid sequence AAGGGCTTTGCCTGACAACACCCA (SEQ ID NO: 33) linked to a fluorescent label.

35. The method of claim 1 , wherein C21orf4 consists of the nucleic acid sequence SEQ ID NO:40, Hs.145049 consists of the nucleic acid sequence SEQ ID NO:42, Hs.296031 consists of the nucleic acid sequence SEQ ID NO:44, KIT consists of the nucleic acid sequence SEQ ID NO:45, SYNGR2 consists of the nucleic acid sequence SEQ ID NO:49, C11orf8 consists of the nucleic acid sequence SEQ ID NO:51, CDH1 consists of the nucleic acid sequence SEQ ID NO:53, IMPACT consists of the nucleic acid sequence SEQ ID NO:55, FAM13A1 consists of the nucleic acid sequence SEQ ID NO:57, and KIAA1128 consists of the nucleic acid sequence SEQ ID NO:59.

36. The method of claim 20 , wherein C21orf4 consists of the nucleic acid sequence SEQ ID NO:40, Hs.145049 consists of the nucleic acid sequence SEQ ID NO:42, Hs.296031 consists of the nucleic acid sequence SEQ ID NO:44, KIT consists of the nucleic acid sequence SEQ ID NO:45, LSM7 consists of the nucleic acid sequence SEQ ID NO:47, and SYNGR2 consists of the nucleic acid sequence SEQ ID NO:49.

Assignments (2)
ASSIGNMENT OF ASSIGNOR'S INTEREST Recorded Dec 21, 2007
From: LIBUTTI, STEVEN; MAZZANTI, CHIARA
To: THE GOVERNMENT OF THE UNITED STATES, AS REPRESENTED BY THE SECRETARY
Reel/Frame 020284/0671 →
ASSIGNMENT OF ASSIGNOR'S INTEREST Recorded Dec 21, 2007
From: ZEIGER, MARTHA; UMBRICHT, CHRISTOPHER
To: THE JOHNS HOPKINS UNIVERSITY
Reel/Frame 020284/0921 →
Continuity (3)
Provisional Application 60560900 · Apr 9, 2004
Provisional Application 60622643 · Oct 26, 2004
Related Publication 20080145841A1 · Jun 19, 2008