Immunostimulatory nucleic acid packaged particles for the treatment of hypersensitivity
The application is related to compositions and methods for the treatment of hypersensitivity, wherein the compositions comprise a particle packaged with immunostimulatory nucleic acids. The compositions of the invention are particularly useful in the treatment of atopic eczema, asthma and IgE-mediated allergy (type I allergy), especially pollen allergy and house dust allergy.
1 . A composition for use in a method of treating hypersensitivity in an animal, wherein said composition comprises:
(a) a particle; and
(b) an immunostimulatory nucleic acid;
wherein said particle is packaged with said immunostimulatory nucleic acid.
2 . The composition of claim 1 , wherein said particle is selected from the group consisting of:
(a) virus-like particle;
(b) virus particle; and
(c) synthetic particle;
3 . The composition of claim 1 , wherein said particle is a virus-like particle.
4 . The composition of claim 3 , wherein said virus-like particle is a virus-like particle of a bacteriophage.
5 . The composition of claim 3 , wherein said virus-like particle is a virus-like particle of a RNA bacteriophage.
6 . The composition of claim 3 , wherein said virus-like particle comprises recombinant proteins, or fragments thereof, of a RNA bacteriophage.
7 . The composition of claim 3 , wherein said virus-like particle comprises coat proteins, or fragments thereof, of a RNA bacteriophage.
8 . The composition of claim 5 , wherein said RNA bacteriophage is selected from the group consisting of:
(a) bacteriophage Qβ;
(b) bacteriophage R17;
(c) bacteriophage fr;
(d) bacteriophage GA;
(e) bacteriophage SP;
(f) bacteriophage MS2;
(g) bacteriophage M11;
(h) bacteriophage MX1;
(i) bacteriophage NL95;
(j) bacteriophage f2;
(k) bacteriophage PP7; and
(l) bacteriophage AP205.
9 . The composition of claim 5 , wherein said RNA bacteriophage is Qβ.
10 . The composition of claim 5 , wherein said RNA bacteriophage is AP205.
11 . The composition of claim 5 , wherein said RNA bacteriophage is fr.
12 . The composition of claim 5 , wherein said RNA bacteriophage is GA.
13 . The composition of claim 1 , wherein said particle is a synthetic particle.
14 . The composition of claim 13 , wherein said synthetic particle is selected from the group consisting of:
(a) nanoparticle;
(b) microparticle;
(c) liposome; and
(d) virosome.
15 . The composition of 1 , wherein said particle is a nanoparticle.
16 . The composition of 15 , wherein said nanoparticle comprises a biodegradable material.
17 . The composition of 16 , wherein said biodegradable material is selected from:
(a) polyesters;
(b) copolymers of polyesters;
(c) block copolymers of polyester and PEG;
(d) polyorthoesters;
(e) poly(anhydrides);
(f) poly(sebacic acid);
(g) polyanhydrides based on sebacic acid monomers incorporating amino acids;
(h) polyanhydride esters;
(i) polyphosphazene, and
(j) polyamide.
18 . The composition of claim 15 , wherein said particle is a nanoparticle selected from the group consisting of:
(a) pegylated polyester nanoparticle;
(b) polyalkylcyanoacrylate nanoparticle;
(c) pegylated polyalkylcyanoacrylate nanoparticle;
(d) alginate-PLL nanoparticle;
(e) chitosan nanoparticle;
(f) CaP-PAA nanoparticle;
(g) gelatine-cholamin nanoparticle; and
(h) human serum albumin nanoparticle.
19 . The composition of claim 1 , wherein said particle is biodegradable.
20 . The composition of claim 1 , wherein said immunostimulatory nucleic acid is capable of stimulating IFN-alpha production in a cell.
21 . The composition of claim 1 , wherein said immunostimulatory nucleic acid is selected from the group consisting of:
(a) desoxyribonucleic acid;
(b) ribonucleic acid,
(c) chimeric nucleic acid; and
(d) any mixtures of at least one nucleic acid of (a), (b) and/or (c).
22 . The composition of claim 1 , wherein said immunostimulatory nucleic acid is an unmethylated CpG containing oligonucleotide.
23 . The composition of claim 22 , wherein said unmethylated CpG containing oligonucleotide is selected from the group consisting of:
(a) A-type CpG; and
(b) C-type CpG.
24 . The composition of claim 22 , wherein said unmethylated CpG-containing oligonucleotide is an A-type CpG.
25 . The composition of claim 22 , wherein said unmethylated CpG-containing oligonucleotide comprises a palindromic sequence.
26 . The composition of claim 22 , wherein the CpG motif of said unmethylated CpG-containing oligonucleotide is part of a palindromic sequence.
27 . The composition of claim 25 , wherein said palindromic sequence is GACGATCGTC (SEQ ID NO:28).
28 . The composition of claim 25 , wherein said palindromic sequence is flanked at its 5′-terminus and at its 3′-terminus by guanosine entities.
29 . The composition of claim 25 , wherein said palindromic sequence is flanked at its 5′-terminus by at least 3 and at most 15 guanosine entities, and wherein said palindromic sequence is flanked at its 3′-terminus by at least 3 and at most 15 guanosine entities.
30 . The composition of claim 22 , wherein said unmethylated CpG-containing oligonucleotide comprises or alternatively consists of the sequence selected from the group consisting of:
(SEQ ID NO:32)
(a) “G6-6” GGGGGGGACGATCGTCGGGGGG;
(SEQ ID NO:33)
(b) “G7-7” GGGGGGGGACGATCGTCGGGGGGG
(SEQ ID NO:25)
(c) “G8-8” GGGGGGGGGACGATCGTCGGGGGGGG;
(SEQ ID NO:26)
(d) “G9-9” GGGGGGGGGGACGATCGTCGGGGGGGGG;
and
(SEQ ID NO:27)
(e) “G10” GGGGGGGGGGGACGATCGTCGGGGGGGGGG.
31 . The composition of claim 22 , wherein said unmethylated CpG-containing oligonucleotide comprises the sequence GGGGGGGGGGGACGATCGTCGGGGGGGGGG (SEQ ID NO:27).
32 . The composition of claim 22 , wherein said unmethylated CpG-containing oligonucleotide consists exclusively of phosphodiester bound nucleotides.
33 . The composition of claim 22 , wherein said immunostimulatory nucleic acid, preferably said unmethylated CpG-containing oligonucleotide, is not accessible to DNAse hydrolysis.
34 . The composition of claim 1 , wherein said immunostimulatory nucleic acid is an unmethylated CpG-containing oligonucleotide, and wherein said unmethylated CpG-containing oligonucleotide is not accessibly to Benzonase hydrolysis.
35 . The composition of claim 1 , wherein said immunostimulatory nucleic acid is an unmethylated CpG containing oligonucleotide consisting of the sequence GGGGGGGGGGGACGATCGTCGGGGGGGGGG (SEQ ID NO:27), and wherein said unmethylated CpG-containing oligonucleotide consists exclusively of phosphodiester bound nucleotides.
36 . The composition of claim 1 , wherein said immunostimulatory nucleic acid is a double stranded ribonucleic acid, wherein said double stranded ribonucleic acid is poly(I:C) or a derivative thereof.
37 . The composition of claim 1 , wherein said hypersensitivity is selected from the group consisting of
(a) allergy; and
(b) non-allergic hypersensitivity.
38 . The composition of claim 1 , wherein said hypersensitivity is an allergy.
39 . The composition of claim 38 , wherein said allergy is an IgE-mediated allergy.
40 . The composition of claim 1 , wherein said hypersensitivity is asthma.
41 . The composition of claim 40 , wherein said asthma is IgE-mediated asthma.
42 . The composition of claim 1 , wherein said hypersensitivity is dermatitis.
43 . The composition of claim 42 , wherein said dermatitis is an atopic eczema.
44 . The composition of claim 1 , wherein said hypersensitivity is an IgE-mediated allergy (type I allergy).
45 . The composition of claim 1 , wherein said hypersensitivity is an IgE-mediated allergy against a naturally occurring allergen.
46 . The composition of claim 44 , wherein said IgE-mediated allergy is selected from the group consisting of:
(a) pollen allergy (hay fever);
(b) house dust allergy;
(c) food allergy;
(d) drug allergy;
(e) insect venom allergy, preferably bee venom allergy; and
(f) animal allergy, preferably cat allergy.
47 . The composition of claim 44 , wherein said IgE-mediated allergy is pollen allergy or house dust allergy.
48 . The composition of claim 1 , wherein said animal is a human.
49 . The composition of claim 1 , wherein said composition is free of an allergen or an allergen extract.
50 . A pharmaceutical composition comprising:
(a) the composition of claim 1; and
(b) an adjuvant, preferably an aluminium containing adjuvant, most preferably alhydrogel.
51 . A pharmaceutical composition for use in a method for treating hypersensitivity in an animal, said pharmaceutical composition comprising:
(a) the composition of claim 1; and
(b) an adjuvant, preferably an aluminium containing adjuvant, most preferably alhydrogel.
52 . A method of treating hypersensitivity in an animal, said method comprising introducing into said animal the composition of claim 1 .
53 . The method of claim 52 , wherein said composition is introduced into said animal subcutaneously, intramuscularly, intravenously, intranasally or directly into the lymph node.
54 . The method of claim 52 , wherein said animal is a mammal, preferably a human.
55 . The method of claim 52 , wherein said introducing into said animal is repeated at least twice, preferably three times in intervals of 1 week to 3 months, preferably in intervals of 2 weeks.
56 . The method of claim 52 , wherein said introducing into said animal is repeated 6 times in weekly intervals, wherein preferably each time 50 μg to about 500 μg, most preferably about 300 μg, of said composition are introduced.
57 . The method of claim 52 , wherein said composition is introduced in said animal without an allergen or allergen extract.
58 . The method of claim 52 , wherein said composition is introduced in said animal without administration of an allergen or allergen extract.
59 . The method of claim 52 , wherein said composition is not introduced in said animal in conjunction with an allergen or allergen extract.
60 . The method of claim 52 , wherein said composition is introduced in said animal, and wherein said introduction of said composition into said animal is effected such as an allergen or allergen extract is not introduced in said animal for at least one week before and at least one week after said introduction of said composition in said animal.
61 . The method of claim 52 , wherein said composition is introduced in said animal, and wherein said introduction of said composition into said animal is effected such as an allergen or allergen extract is not introduced in said animal for at least four weeks before and at least four weeks after said introduction of said composition in said animal.
62 . The method of claim 52 , wherein said composition is introduced in said animal, and wherein said introduction of said composition into said animal is effected such as an allergen or allergen extract is not introduced in said animal for at least eight weeks before and at least eight weeks after said introduction of said composition in said animal.
63 . The method of claim 52 , wherein said composition is introduced in said animal, and wherein said introduction of said composition into said animal is effected such as an allergen or allergen extract is not introduced at all in said animal.
64 . (canceled)
65 . (canceled)
66 . The method of claim 52 , wherein said particle is a virus-like particle of a RNA bacteriophage.
67 . The method of claim 66 , wherein said RNA bacteriophage is Qβ.
68 . The method of claim 52 , wherein said immunostimulatory nucleic acid is an unmethylated CpG containing oligonucleotide.
69 . The method of claim 52 , wherein said immunostimulatory nucleic acid is an unmethylated CpG containing oligonucleotide consisting of the sequence GGGGGGGGGGGACGATCGTCGGGGGGGGGG (SEQ ID NO:27), and wherein said unmethylated CpG-containing oligonucleotide consists exclusively of phosphodiester bound nucleotides.
70 . The method of claim 52 , wherein said hypersensitivity is an allergy.
71 . The method of claim 70 , wherein said allergy is selected from the group consisting of:
(a) IgE-mediated asthma;
(b) atopic eczema; and
(c) IgE-mediated allergy (type I allergy), preferably pollen allergy or house dust allergy.
72 . The method of claim 52 , wherein said composition is free of an allergen or an allergen extract.
73 . (canceled)
74 . (canceled)
75 . (canceled)
76 . (canceled)
77 . (canceled)
78 . (canceled)
79 . (canceled)