Methods and compositions for treating and preventing neurologic disorders
The present invention provides methods for treating or reducing neurologic disorders.
1. A method of treating cerebral ischemic disease by administering directly to a neural cell of a mammal an RNA interfering molecule that specifically targets and reduces the level or activity of human prolyl isomerase Pin1.
2. The method of claim 1 , wherein said cerebral ischemic disease is stroke.
3. The method of claim 1 , wherein said neural cell is a granule neuron.
4. The method of claim 1 , wherein said mammal is further administered a second therapeutic regimen.
5. The method of claim 1 , wherein said RNA interfering molecule specificallytargets GAGACCTGGGTGCCTTCAGCA (SEQ ID NO: 1)in Pin 1 mRNA.
6. The method of claim 1 , wherein said RNA interfering molecule is administered intrathecally.