Retinoid metabolizing protein
Amino acid sequences and corresponding nucleic acid sequence of retinoid metabolizing protein found in human, mouse and zebrafish are described, as well as methods of using same.
1 . A method of screening drugs for their effect on expression of a gene wherein the gene is inducible by a retinoid, comprising:
(A) exposing a recombinant DNA to a said drug, and
(B) determining the effect on gene expression,
wherein the recombinant DNA comprises:
(i) a nucleotide sequence selected from the group consisting of:
(a) SEQ ID NO:33;
(b) SEQ ID NO:34;
(c) SEQ ID NO:35; and
(d) a fragment of (a), (b) or (c), wherein said DNA fragment possesses promoter activity; and
(ii) at least one structural gene.
2 . The method of claim 1 including exposing the recombinant DNA in the presence of a said retinoid.
3 . The method of claim 1 wherein the at least one structural gene comprises a reporter gene that does not metabolize retinoic acid.
4 . The method of claim 1 wherein the at least one structural gene comprises at least one cytochrome P450.
5 . The method of claim 1 wherein determining the effect on gene expression includes ascertaining the effect on transcription of the gene.
6 . The method of claim 2 wherein the retinoid is a retinoic acid.
7 . The method of claim 6 wherein the retinoic acid is all-trans-retinoic acid.
8 . The method of claim 1 wherein said recombinant DNA includes the sequence TGAACTNNNNNTGAACT, where “N” can be any nucleotide and there can be 0 to 5 N (SEQ ID NO:39).
9 . The method of claim 8 wherein there are 5 N.
10 . The method of claim 8 wherein said recombinant DNA further includes the sequence TCTGASSAAGKTAAC (SEQ ID NO:40) downstream from the sequence TGAACTNNNNNTGAACT (SEQ ID NO:39).
11 . The method of claim 10 wherein said recombinant DNA further includes the sequence AATT between the sequence TGAACTNNNNNTGAACT (SEQ ID NO:39) and the sequence TCTGASSAAGKTAAC (SEQ ID NO:40).
12 . The method of claim 10 wherein there are up to six nucleotides between the sequence TGAACTNNNNNTGAACT (SEQ ID NO:39) and the sequence TCTGASSAAGKTAAC (SEQ ID NO:40).
13 . The method of claim 8 wherein said recombinant DNA further includes the sequence CAATTAAAGA (SEQ ID NO:41) upstream of the sequence TGAACTNNNNNTGAACT (SEQ ID NO:39).
14 . The method of claim 1 wherein said recombinant DNA includes the sequence CAATTAAAGATGAACTTTGGGTGAACTAATT (SEQ ID NO:42).
15 . The method of any of claims 1 to 14 wherein said recombinant DNA includes the sequence TATAA.
16 . The method of claim 8 , 9 or 13 wherein said recombinant DNA includes the sequence TATAA downstream of the sequence TGAACTNNNNNTGAACT (SEQ ID NO:39).
17 . The method of claim 10 or 11 wherein said recombinant DNA includes the sequence TATAA downstream of the sequence TCTGASSAAGKTAAC (SEQ ID NO:40).
18 . The method of claim 8 wherein said recombinant DNA includes the sequence TATAA located downstream of the sequence TGAACTNNNNNTGAACT (SEQ ID NO:39) and spaced up to about 55 nucleotides therefrom.