Peptide-conjugated oligonucleotide therapeutic and method of making and using same
Conjugates for the efficient delivery of sequence-specific antisense to cells of a selected type for the inhibition of a target protein have the general formula: peptide-HBL-antisense in which the peptide is a homing peptide which directs the conjugate to cells of a particular type, antisense is an antisense oligonucleotide having a sequence selected to provide sequence-specific inhibition of the target protein, and HBL is a heterobifunctional linker having reactivity towards amino and sulfhydryl groups.
1. A peptide-oligonucleotide conjugate having the general formula:
homing element-GMBS-antisense
in which homing element is a means for directing the conjugate to cells of a particular type, antisense is an antisense gapmer oligonucleotide having a sequence selected to provide sequence-specific inhibition of a target protein, and GMBS is a linking group formed by reaction of 4-maleimidobutyric acid N-hydroxysuccinimide ester with the homing element and the antisense.
2. A peptide-oligonucleotide conjugate having the general formula:
peptide-HBL-antisense
in which peptide is a homing peptide which directs the conjugate to cells of a particular type, antisense is an antisense oligonucleotide having a sequence selected to provide sequence-specific inhibition of a target protein, and HBL is a heterobifunctional linker having reactivity towards amino and sulfhydryl groups, in which the peptide directs the conjugate to tumor endothelium, and in which the antisense oligonucleotide comprises the Seq ID No. 1 or 31 or an RNA counter-part thereof.
3. The conjugate of claim 1 , in which the antisense gapmer oligonucleotide targets a transcription regulating factor in a sequence specific manner.
4. The conjugate of claim 1 in which the antisense gapmer oligonucleotide targets Id1.
5. The conjugate of claim 4 in which the antisense gapmer oligonucleotide comprises the sequence gcaccagctccttgaggcgtgag (Seq. ID No. 1) or an RNA counter-part thereof.
6. The conjugate of claim 1 , in which the homing element directs the conjugate to tumor endothelium.
7. The conjugate of claim 6 , in which the homing element portion of the conjugate comprises a peptide of the sequence:
(Seq. ID No. 3)
CKDEPQRRSARLSAKPAPPKPEPKPKKAPAKK.
8. The conjugate of claim 6 , wherein the homing element portion of the conjugate comprises a peptide of the sequence:
(Seq. ID No. 4)
WIFPWIQL
or
(Seq. ID No. 5)
WDLAWMFRLPVG.
9. The conjugate of claim 6 , in which the antisense gapmer oligonucleotide targets a transcription regulating factor in a sequence specific manner.
10. The conjugate of claim 6 in which the antisense gapmer oligonucleotide targets Id1.
11. The conjugate of claim 10 in which the antisense gapmer oligonucleotide comprises the sequence gcaccagctccttgaggcgtgag (Seq. ID No. 1) or an RNA counter-part thereof.
12. The conjugate of claim 1 , wherein the homing element portion of the conjugate comprises a sequence selected from Seq. ID Nos. 10-30 and 33-35.
13. A peptide-oligonucleotide conjugate having the general formula:
peptide-HBL-antisense
in which peptide is a homing peptide which directs the conjugate to cells of a particular type, antisense is an antisense oligonucleotide having a sequence selected to provide sequence-specific inhibition of a target protein, and HBL is a heterobifunctional linker having reactivity towards amino and sulfhydryl groups, in which the antisense oligonucleotide comprises Seq. ID No. 1 or 31 or an RNA counter-part thereof.
14. The conjugate of claim 13 , in which HBL is GMBS or EMCS.
15. The conjugate of claim 2 , in which HBL is GMBS or EMCS.
16. The conjugate of claim 1 , wherein the antisense gapmer oligonucleotide consists of SEQ ID NO.: 2.
17. The conjugate of claim 3 , wherein the antisense gapmer oligonucleotide consists of SEQ ID NO.: 2.
18. The conjugate of claim 4 , wherein the antisense gapmer oligonucleotide consists of SEQ ID NO.: 2.
19. The conjugate of claim 10 , wherein the antisense gapmer oligonucleotide consists of SEQ ID NO.: 2.
20. The conjugate of claim 1 , wherein the means for directing the conjugate to cells of a particular type targets the conjugate to glioma cells.
21. The conjugate of claim 20 , wherein the homing element portion of the conjugate comprises a sequence selected from the group consisting of SEQ ID NOs: 33, 34 and 35.
22. The conjugate of claim 1 , wherein the means for directing the conjugate to cells of a particular type targets the conjugate to angiosarcoma cells.
23. The conjugate of claim 22 , wherein the homing element portion of the conjugate comprises a sequence selected from the group consisting of SEQ ID NOs: 10, 11, 12, 13, and 14.
24. The conjugate of claim 1 , wherein the means for directing the conjugate to cells of a particular type targets the conjugate to breast cancer cells.
25. The conjugate of claim 22 , wherein the homing element portion of the conjugate comprises a sequence selected from the group consisting of SEQ ID NOs: 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 and 30.