Selection of RNA-aptamers as anti-malaria agents
The present invention relates to an aptamer or an active fragment thereof raised against the semi-conserved duffy binding ligand domain 1α, DBL1α, region of the Plasmodium falciparum erythrocyte membrane protein 1, PfEMPI, which aptamer has an effect against malaria, in particular severe cerebral malaria.
1. An aptamer consisting of the sequence AACAAUACGACUACACCAUCAAAAGUAUUAUCUUGCAUCGAAGGUUGGCA (SEQ ID NO:5.
2. An aptamer which is a fluorinated aptamer of SEQ ID NO: 5 having sequence AAC F AAU F AC F GAC F U F AC F AC F C F AU F C F AAAAGU F AU F U F AU F C F U F U F GC F AU F C F GAAGG U F U F GGC F A (SEQ ID NO: 11).
3. The aptamer of claim 1 , wherein the aptamer consists of the sequence SEQ ID NO: 5.
4. The aptamer of claim 2 , wherein the aptamer consists of the sequence set forth in SEQ ID NO: 11.
5. An aptamer comprising a polynucleotide having SEQ ID NO: 5.
6. The aptamer of claim 5 , wherein the aptamer comprises the sequence having SEQ ID NO: 5.
7. An aptamer which is the fluorinated aptamer SEQ ID NO: 5, comprising a polynucleotide sequence having SEQ ID NO: 11.
8. The aptamer of claim 7 , wherein the aptamer comprises a polynucleotide sequence having SEQ ID NO: 11.