Spinal muscular atrophy (SMA) treatment via targeting of SMN2 splice site inhibitory sequences
The present invention is directed to methods and compositions capable of blocking the inhibitory effect of a newly-identified intronic inhibitory sequence element, named ISS-N1 (for “intronic splicing silencer”), located in the SMN2 gene. The compositions and methods of the instant invention include oligonucleotide reagents (e.g., oligoribonucleotides) that effectively target the SMN2 ISS-N1 site in the SMN2 pre-mRNA, thereby modulating the splicing of SMN2 pre-mRNA to include exon 7 in the processed transcript. The ISS-N1 blocking agents of the invention cause elevated expression of SMN protein, thus compensating for the loss of SMN protein expression commonly observed in subjects with spinal muscular atrophy (SMA).
1. A method of increasing the level of exon 7-containing SMN2 mRNA in a cell, comprising contacting the cell with a peptide nucleic acid (PNA) that is at least 80% complementary to intron 7 of the SMN2 gene over the entire length of the PNA and is at least 85% complementary to the sequence set forth as SEQ ID NO:1 or SEQ ID NO:3, and wherein the PNA is 15-40 nucleobases in length, such that the level of exon 7-containing SMN2 mRNA in the cell is increased.
2. The method of claim 1 , wherein the PNA is 10-15 nucleobases in length.
3. The method of claim 1 , wherein PNA is 15-20 nucleobases in length.
4. The method of claim 1 , wherein at least one nucleobase is a modified nucleobase.
5. The method of claim 1 , wherein the method is performed in vitro.
6. The method of claim 5 , wherein the cell is an embryonic stem cell.
7. A method of increasing the level of exon 7-containing SMN2 mRNA in an organism, comprising administering to the organism a peptide nucleic acid (PNA) that is at least 80% complementary to intron 7 of the SMN2 gene over the entire length of the PNA and is at least 85% complementary to the sequence set forth as SEQ ID NO:1 or SEQ ID NO:3, and wherein the PNA is 15-40 nucleobases in length, such that the level of exon 7-containing SMN2 mRNA in the organism extract is increased.
8. The method of claim 7 , wherein the organism is a mammal.
9. The method of claim 7 , wherein the organism is a human.
10. The method of claim 7 , wherein the human has spinal muscular atrophy (SMA).
11. A method of treating spinal muscular atrophy (SMA) in a patient, comprising administering to the patient a peptide nucleic acid (PNA) that is at least 80% complementary to intron 7 of the SMN2 gene over the entire length of the PNA and is at least 85% complementary to the sequence set forth as SEQ ID NO:1 or SEQ ID NO:3, in a dose effective to increase the level of exon 7-containing SMN2 mRNA in cells of the patient, such that SMA in the patient is treated.
12. A method for inhibiting an SMN2 pre-mRNA intronic splicing silencer site in a cell comprising contacting the cell or cell extract with a peptide nucleic acid (PNA) 100% complementary to the ISSN-N1 sequence set forth in SEQ ID NO:1, such that the SMN2 intronic splicing silencer site is inhibited.
13. A method for inhibiting an SMN2 pre-mRNA intronic splicing silencer site in an organism comprising administering to the organism a peptide nucleic acid (PNA) 100% complementary to the ISSN-N1 sequence set forth in SEQ ID NO:1, such that the SMN2 intronic splicing silencer site is inhibited.
14. A method of administering a peptide nucleic acid to a subject that would benefit from enhanced levels of exon 7-containing SMN2 mRNA in neuronal cells, comprising administering to the subject a PNA that is at least 80% complementary to intron 7 of the SMN2 gene over the entire length of the PNA and is at least 85% complementary to the sequence set forth as SEQ ID NO:1 or SEQ ID NO:3, wherein the PNA is administered in a dose effective to enhance the level of exon 7-containing SMN2 mRNA in cells of the subject.
15. The method of claim 14 , wherein the subject is suffering from amyotrophic lateral sclerosis (ALS).
16. The method of claim 1 , wherein the method is performed in vivo.
17. The method of claim 5 , wherein the cell is selected from the group consisting of a spinal muscular atrophy (SMA) patient-derived neuronal cell, a spinal muscular atrophy (SMA) patient-derived muscle cell and a spinal muscular atrophy (SMA) patient-derived fibroblast.
18. The method of claim 15 , wherein the subject is suffering from spinal muscular atrophy (SMA).
19. The method of any one of claims 1 , 7 , 11 and 14 , wherein the PNA is at least 90% complementary to the sequence set forth as SEQ ID NO:1 or SEQ ID NO:3.
20. The method of any one of claims 1 , 7 , 11 and 14 , wherein the PNA is 100% complementary to the sequence set forth as SEQ ID NO:1 or SEQ ID NO:3.
21. The method of any one of claims 1 , 7 , 11 and 14 , wherein the PNA is 100% complementary to intron 7 of the SMN2 gene over the entire length of the PNA.
22. The method of any one of claims 1 , 7 , 11 and 14 , wherein the PNA is 20-25 nucleobases in length.
23. The method of any one of claims 1 , 7 , 11 and 14 , wherein the PNA is 18 nucleobases in length.
24. The method of claim 4 , wherein the nucleobase is derivitized at a position selected from the group consisting of the 5 position, the 7 position and the 8 position.
25. The method of claim 4 , wherein the modified nucleobase is selected from the group consisting of 5-(2-amino)propyl uridine, 5-bromo uridine, 8-bromo guanosine, 7-deaza-adenosine, and N6-methyl adenosine.
26. The method of claim 1 , which comprises the complement of the nucleobase sequence CCAGCAUUAUGAAAGUGAAU, set forth as nucleobases 10-29 of SEQ ID NO:103.
27. The method of claim 1 , which consists of the complement of the nucleobase sequence CCAGCAUUAUGAAAGUGAAU, set forth as nucleobases 10-29 of SEQ ID NO:103.