Treatment of inflammatory diseases using miR-124
Methods of treating, reducing the risk of developing, or delaying the onset of an inflammatory disease are disclosed. The methods involved providing a subject with or at risk of developing an inflammatory disease and administering to the subject an effective amount of a first therapeutic composition comprising miR-124. Further provided are methods of diagnosing a subject with or at risk of developing an inflammatory disease.
1. A method of treating multiple sclerosis in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of micro RNA-124 (miR-124) comprising the sequence UAAGGCACGCGGUGAAUGCC (SEQ ID NO:1).
2. The method of claim 1 , wherein the multiple sclerosis is characterized by activation of macrophages.
3. The method of claim 1 , wherein the miR-124 is formulated for systemic administration.
4. The method of claim 1 , wherein the miR-124 is modified.
5. The method of claim 1 , wherein the miR-124 is modified to include a cholesterol group, 2′-O-methyl group, a 2′-fluoro group, a 2′-O-methyoxyethyl group, a phosphorothiate group, a boranophosphate group, or a 4′-thioribose group.