KRAS Primers and Probes
The present invention provides oligonucleotide primers or probes for the detection of a mutation of the KRAS gene. The invention also provides a method for detecting a mutation in the KRAS gene using the oligonucleotide primers or probes disclosed therein. Furthermore, the present invention encompasses a method for predicting the sensitivity of a tumor in a patient to epidermal growth factor receptor-directed chemotherapy, comprising obtaining DNA from the tumor; and determining whether there is a mutation in codon 12 and/or a mutation in codon 13 in exon 2 of the KRAS gene in the DNA using a method utilizing at least one of the oligonucleotide primers and/or probes of the present invention.
1 . An oligonucleotide selected from:
(a) an oligonucleotide consisting of a nucleotide sequence of GTCAAGGCACTCTTGCCTAAGT (SEQ ID NO:1) or an oligonucleotide substantially identical thereto;
(b) an oligonucleotide consisting of a nucleotide sequence of GGCCTGCTGAAAATGACTGA (SEQ ID NO:2) or an oligonucleotide substantially identical thereto;
(c) a labeled oligonucleotide consisting of a nucleotide sequence of
6FAM-CAACTACCACAAGTTT (SEQ ID NO:3) or an oligonucleotide substantially identical thereto;
(d) an oligonucleotide consisting of a nucleotide sequence of AGGCACTCTTGCCTCCGT (SEQ ID NO:4) or an oligonucleotide substantially identical thereto;
(e) an oligonucleotide consisting of a nucleotide sequence of GCCTGCTGAAAATGACTGAATAT (SEQ ID NO:5) or an oligonucleotide substantially identical thereto;
(f) a labeled oligonucleotide consisting of a nucleotide sequence of 6FAM-CTCCAACTACCACAAGTT (SEQ ID NO: 6) or an oligonucleotide substantially identical thereto;
(g) an oligonucleotide consisting of a nucleotide sequence of CTTGTGGTAGTTGGAGCTGGTAA (SEQ ID NO: 7) or an oligonucleotide substantially identical thereto;
(h) an oligonucleotide consisting of a nucleotide sequence of AATATAAACTTGTGGTAGTTGGAGCTTT (SEQ ID NO: 8) or an oligonucleotide substantially identical thereto;
(i) an oligonucleotide consisting of a nucleotide sequence of GAATATAAACTTGTGGTAGTTGGAGCTAT (SEQ ID NO: 9) or an oligonucleotide substantially identical thereto;
(j) an oligonucleotide consisting of a nucleotide sequence of TATAAACTTGTGGTAGTTGGAGGTGT (SEQ ID NO: 10) or an oligonucleotide substantially identical thereto;
(k) an oligonucleotide consisting of a nucleotide sequence of TGAAGATGTACCTATGGTCCTAGTAGGA (SEQ ID NO: 11) or an oligonucleotide substantially identical thereto;
(l) an oligonucleotide consisting of a nucleotide sequence of GTCCTGAGCCTGTTTTGTGTCTA (SEQ ID NO: 12) or an oligonucleotide substantially identical thereto;
(m) a labeled oligonucleotide consisting of a nucleotide sequence of 6FAM-TAGAAGGCAAATCACA (SEQ ID NO: 13) or an oligonucleotide substantially identical thereto;
(n) an oligonucleotide consisting of a nucleotide sequence of TGAATATAAACTTGTGGTAGTTGGAGATA (SEQ ID NO:14) or an oligonucleotide substantially identical thereto;
(o) an oligonucleotide consisting of a nucleotide sequence of AATATAAACTTGTGGTAGTTGGAGGTC (SEQ ID NO:15) or an oligonucleotide substantially identical thereto;
(p) an oligonucleotide consisting of a nucleotide sequence of TGAATATAAACTTGTGGTAGTTGGAGTTT (SEQ ID NO:16) or an oligonucleotide substantially identical thereto;
(q) an oligonucleotide consisting of a nucleotide sequence of AAACTTGTGGTAGTTGGAGCAGA (SEQ ID NO:17) or an oligonucleotide substantially identical thereto;
(r) an oligonucleotide consisting of a nucleotide sequence of AACTTGTGGTAGTTGGAGCAGC (SEQ ID NO:18) or an oligonucleotide substantially identical thereto;
(s) an oligonucleotide consisting of a nucleotide sequence of CACAAAATGATTCTGAATTAGCTGTATC (SEQ ID NO:19) or an oligonucleotide substantially identical thereto; and
(t) a labeled oligonucleotide consisting of 6FAM-TCAAGGCACTCTTGCCT (SEQ ID NO:20) or an oligonucleotide substantially identical thereto.
2 . The oligonucleotide of claim 1 , selected from:
an oligonucleotide consisting of a nucleotide sequence of GTCAAGGCACTCTTGCCTAAGT (SEQ ID NO:1) or an oligonucleotide substantially identical thereto;
an oligonucleotide consisting of a nucleotide sequence of GGCCTGCTGAAAATGACTGA (SEQ ID NO:2) or an oligonucleotide substantially identical thereto;
an oligonucleotide consisting of a nucleotide sequence of AGGCACTCTTGCCTCCGT (SEQ ID NO:4) or an oligonucleotide substantially identical thereto;
an oligonucleotide consisting of a nucleotide sequence of GCCTGCTGAAAATGACTGAATAT (SEQ ID NO:5) or an oligonucleotide substantially identical thereto;
an oligonucleotide consisting of a nucleotide sequence of CTTGTGGTAGTTGGAGCTGGTAA (SEQ ID NO: 7) or an oligonucleotide substantially identical thereto;
an oligonucleotide consisting of a nucleotide sequence of AATATAAACTTGTGGTAGTTGGAGCTTT (SEQ ID NO: 8) or an oligonucleotide substantially identical thereto;
an oligonucleotide consisting of a nucleotide sequence of GAATATAAACTTGTGGTAGTTGGAGCTAT (SEQ ID NO: 9) or an oligonucleotide substantially identical thereto;
an oligonucleotide consisting of a nucleotide sequence of TATAAACTTGTGGTAGTTGGAGGTGT (SEQ ID NO: 10) or an oligonucleotide substantially identical thereto;
an oligonucleotide consisting of a nucleotide sequence of TGAAGATGTACCTATGGTCCTAGTAGGA (SEQ ID NO: 11) or an oligonucleotide substantially identical thereto;
an oligonucleotide consisting of a nucleotide sequence of GTCCTGAGCCTGTTTTGTGTCTA (SEQ ID NO: 12) or an oligonucleotide substantially identical thereto;
an oligonucleotide consisting of a nucleotide sequence of TGAATATAAACTTGTGGTAGTTGGAGATA (SEQ ID NO:14) or an oligonucleotide substantially identical thereto;
an oligonucleotide consisting of a nucleotide sequence of AATATAAACTTGTGGTAGTTGGAGGTC (SEQ ID NO:15) or an oligonucleotide substantially identical thereto;
an oligonucleotide consisting of a nucleotide sequence of TGAATATAAACTTGTGGTAGTTGGAGTTT (SEQ ID NO:16) or an oligonucleotide substantially identical thereto;
an oligonucleotide consisting of a nucleotide sequence of AAACTTGTGGTAGTTGGAGCAGA (SEQ ID NO:17) or an oligonucleotide substantially identical thereto;
an oligonucleotide consisting of a nucleotide sequence of AACTTGTGGTAGTTGGAGCAGC (SEQ ID NO:18) or an oligonucleotide substantially identical thereto; and
an oligonucleotide consisting of a nucleotide sequence of CACAAAATGATTCTGAATTAGCTGTATC (SEQ ID NO:19) or an oligonucleotide substantially identical thereto.
3 . The oligonucleotide of claim 2 , selected from:
an oligonucleotide consisting of a nucleotide sequence of GTCAAGGCACTCTTGCCTAAGT (SEQ ID NO:1) or an oligonucleotide substantially identical thereto;
an oligonucleotide consisting of a nucleotide sequence of AGGCACTCTTGCCTCCGT (SEQ ID NO:4) or an oligonucleotide substantially identical thereto; and
an oligonucleotide consisting of a nucleotide sequence of CTTGTGGTAGTTGGAGCTGGTAA (SEQ ID NO: 7) or an oligonucleotide substantially identical thereto.
4 . The oligonucleotide of claim 2 , selected from:
an oligonucleotide consisting of a nucleotide sequence of GGCCTGCTGAAAATGACTGA (SEQ ID NO:2) or an oligonucleotide substantially identical thereto; and
an oligonucleotide consisting of a nucleotide sequence of GCCTGCTGAAAATGACTGAATAT (SEQ ID NO:5) or an oligonucleotide substantially identical thereto.
5 . The oligonucleotide of claim 2 , selected from:
an oligonucleotide consisting of a nucleotide sequence of AATATAAACTTGTGGTAGTTGGAGCTTT (SEQ ID NO: 8) or an oligonucleotide substantially identical thereto;
an oligonucleotide consisting of a nucleotide sequence of TGAATATAAACTTGTGGTAGTTGGAGATA (SEQ ID NO:14) or an oligonucleotide substantially identical thereto;
an oligonucleotide consisting of a nucleotide sequence of AATATAAACTTGTGGTAGTTGGAGGTC (SEQ ID NO:15) or an oligonucleotide substantially identical thereto;
an oligonucleotide consisting of a nucleotide sequence of TGAATATAAACTTGTGGTAGTTGGAGTTT (SEQ ID NO:16) or an oligonucleotide substantially identical thereto;
an oligonucleotide consisting of a nucleotide sequence of AAACTTGTGGTAGTTGGAGCAGA (SEQ ID NO:17) or an oligonucleotide substantially identical thereto;
an oligonucleotide consisting of a nucleotide sequence of AACTTGTGGTAGTTGGAGCAGC (SEQ ID NO:18) or an oligonucleotide substantially identical thereto; and
an oligonucleotide consisting of a nucleotide sequence of CACAAAATGATTCTGAATTAGCTGTATC (SEQ ID NO:19) or an oligonucleotide substantially identical thereto.
6 . The oligonucleotide of claim 2 selected from:
an oligonucleotide consisting of a nucleotide sequence of GAATATAAACTTGTGGTAGTTGGAGCTAT (SEQ ID NO: 9) or an oligonucleotide substantially identical thereto; and
an oligonucleotide consisting of a nucleotide sequence of TATAAACTTGTGGTAGTTGGAGGTGT (SEQ ID NO: 10) or an oligonucleotide substantially identical thereto.
7 . The oligonucleotide of claim 2 selected from:
an oligonucleotide consisting of a nucleotide sequence of TGAAGATGTACCTATGGTCCTAGTAGGA (SEQ ID NO: 11) or an oligonucleotide substantially identical thereto; and
an oligonucleotide consisting of a nucleotide sequence of GTCCTGAGCCTGTTTTGTGTCTA (SEQ ID NO: 12) or an oligonucleotide substantially identical thereto.
8 . A kit comprising at least one of the oligonucleotides (a) through (t) according to claim 1 .
9 . The kit of claim 8 , comprising at least one of the oligonucleotides (a), (b), (d), (e), (g), (h), (i), (j), (k), (l), (n), (o), (p), (q), (r) and (s), and at least one of the oligonucleotides (c), (f), (m) and (t).
10 . A method of detecting a KRAS mutation in DNA, comprising:
(1) amplifying the DNA with PCR using a thermostable DNA polymerase lacking 3′ exonuclease activity and
(I) a pair of control oligonucleotide primers for a control assay, wherein the pair of control oligonucleotide primers are for amplification of a DNA region in exon 4 of the KRAS gene, and wherein the pair of control oligonucleotide primers are KrasEx4 Control Forward Primer consisting of the nucleotide sequence represented by SEQ ID NO:11 or an oligonucleotide substantially identical thereto according to claim 1 , and KrasEx4 Control Reverse Primer consisting of the nucleotide sequence represented by SEQ ID NO:12 or an oligonucleotide substantially identical thereto according to claim 1 ; and
(II) at least one pair of mutant oligonucleotide primers for mutation assay, wherein the at least one pair of mutant oligonucleotide primers are for amplification of a DNA region having a mutation in codon 12 and/or a mutation in codon 13 located in exon 2 of the KRAS gene, and wherein the at least one pair of mutant oligonucleotide primers are selected from
(A) a first pair of codon 13 mutant oligonucleotide primers having
(i) a reverse primer selected from (a) 13ASP Reverse Primer consisting of the nucleotide sequence represented by SEQ ID NO:1 or an oligonucleotide substantially identical thereto according to claim 1 , or (b) an oligonucleotide consisting of the nucleotide sequence represented by SEQ ID NO:4 (Kras38A — 3TG-R) or an oligonucleotide substantially identical thereto according to claim 1 , and
(ii) a forward primer selected from (a) C 13 Forward Primer consisting of the nucleotide sequence represented by SEQ ID NO:2 or an oligonucleotide substantially identical thereto according to claim 1 , or (b) an oligonucleotide consisting of the nucleotide sequence represented by SEQ ID NO:5 (KrasC13-F) or an oligonucleotide substantially identical thereto according to claim 1 ;
(B) a second pair of codon 13 mutant oligonucleotide primers having
(i) a forward primer consisting of the nucleotide sequence represented by SEQ ID NO:7 (13ASP Forward Primer) or an oligonucleotide substantially identical thereto according to claim 1 ; and
(ii) a reverse primer consisting of the nucleotide sequence represented by SEQ ID NO:19 (C12 Common Reverse Primer) or an oligonucleotide substantially identical thereto according to claim 1 ; or
(C) at least one pair of codon 12 mutant oligonucleotide primers comprising
(i) at least one forward primer selected from (a) an oligonucleotide consisting of the nucleotide sequence represented by SEQ ID NO:8 (12VAL Forward Primer) or an oligonucleotide substantially identical thereto according to claim 1 ; (b) an oligonucleotide consisting of the nucleotide sequence represented by SEQ ID NO:14 (12SER Forward Primer) or an oligonucleotide substantially identical thereto according to claim 1 ; (c) an oligonucleotide consisting of the nucleotide sequence represented by SEQ ID NO:15 (12ARG Forward Primer) or an oligonucleotide substantially identical thereto according to claim 1 ; (d) an oligonucleotide consisting of the nucleotide sequence represented by SEQ ID NO:16 (12CYS Forward Primer) or an oligonucleotide substantially identical thereto according to claim 1 ; (e) an oligonucleotide consisting of the nucleotide sequence represented by SEQ ID NO:17 (12ASP Forward Primer) or an oligonucleotide substantially identical thereto according to claim 1 ; (f) an oligonucleotide consisting of the nucleotide sequence represented by SEQ ID NO:18 (12ALA Forward Primer) or an oligonucleotide substantially identical thereto according to claim 1 ; (g) an oligonucleotide consisting of the nucleotide sequence represented by SEQ ID NO:9 (KrasM35T — 1GA-F) or an oligonucleotide substantially identical thereto according to claim 1 ; or (h) an oligonucleotide consisting of the nucleotide sequence represented by SEQ ID NO:10 (Kras35T — 3CG-F) or an oligonucleotide substantially identical thereto according to claim 1 ; and
(ii) an oligonucleotide reverse primer consisting of a nucleotide sequence represented by SEQ ID NO:19 (the C12 Common Reverse Primer) or an oligonucleotide substantially identical thereto according to claim 1 ;
(2) determining the product of step (1)(I) comprising an amplification product of the DNA region of exon 4 amplified by the pair of control oligonucleotide primers, wherein the detection of the amplification product indicates the presence of the KRAS gene in the DNA; and
(3) determining the product of step (1)(II) comprising an amplification product of the DNA region of exon 2 amplified by the pair of mutant oligonucleotide primers, wherein
(a) the detection of the amplification product when at least one pair of codon 13 mutant oligonucleotide primers is used in step (1)(II) indicates the presence of a mutation in codon 13 in exon 2 of the KRAS gene in the DNA; and/or
(b) the detection of the amplification product when at least one pair of codon 12 mutant oligonucleotide primers is used in step (1)(II) indicates the presence of a mutation in codon 12 in exon 2 of the KRAS gene in the DNA.
11 . The method of claim 10 , wherein in step (1)(II), the at least one pair of mutant oligonucleotide primers used in step (1)(II) are for amplification of the DNA region having a mutation in codon 12 located in exon 2 of the KRAS gene, the at least one pair of mutant oligonucleotide primers for codon 12 comprising
(i) at least one forward primer selected from (a) an oligonucleotide consisting of the nucleotide sequence represented by SEQ ID NO:8 (12VAL Forward Primer) or an oligonucleotide substantially identical thereto according to claim 1 ; (b) an oligonucleotide consisting of the nucleotide sequence represented by SEQ ID NO:14 (12SER Forward Primer) or an oligonucleotide substantially identical thereto according to claim 1 ; (c) an oligonucleotide consisting of the nucleotide sequence represented by SEQ ID NO:15 (12ARG Forward Primer) or an oligonucleotide substantially identical thereto according to claim 1 ; (d) an oligonucleotide consisting of the nucleotide sequence represented by SEQ ID NO:16 (12CYS Forward Primer) or an oligonucleotide substantially identical thereto according to claim 1 ; (e) an oligonucleotide consisting of the nucleotide sequence represented by SEQ ID NO:17 (12ASP Forward Primer) or an oligonucleotide substantially identical thereto according to claim 1 ; (f) an oligonucleotide consisting of the nucleotide sequence represented by SEQ ID NO:18 (12ALA Forward Primer) or an oligonucleotide substantially identical thereto according to claim 1 ; (g) an oligonucleotide consisting of the nucleotide sequence represented by SEQ ID NO:9 (KrasM35T — 1GA-F) or an oligonucleotide substantially identical thereto according to claim 1 ; or (h) an oligonucleotide consisting of the nucleotide sequence represented by SEQ ID NO:10 (Kras35T — 3CG-F) or an oligonucleotide substantially identical thereto according to claim 1 ; and
(ii) an oligonucleotide reverse primer consisting of a nucleotide sequence represented by SEQ ID NO:19 (the C12 Common Reverse Primer) or an oligonucleotide substantially identical thereto according to claim 1 .
12 . The method of claim 10 , wherein in step (1)(II), the at least one pair of mutant oligonucleotide primers used in step (1)(II) are for amplification of the DNA region having a mutation in codon 13 located in exon 2 of the KRAS gene, the at least one pair of mutant oligonucleotide primers for codon 13 is selected from
(A) a first pair of codon 13 mutant oligonucleotide primers comprising
(i) a reverse primer selected from (a) 13ASP Reverse Primer consisting of the nucleotide sequence represented by SEQ ID NO:1 or an oligonucleotide substantially identical thereto according to claim 1 , or (b) an oligonucleotide consisting of the nucleotide sequence represented by SEQ ID NO:4 (Kras38A — 3TG-R) or an oligonucleotide substantially identical thereto, and
(ii) a forward primer selected from (a) C 13 Forward Primer consisting of the nucleotide sequence represented by SEQ ID NO:2 or an oligonucleotide substantially identical thereto according to claim 1 , or (b) an oligonucleotide consisting of the nucleotide sequence represented by SEQ ID NO:5 (KrasC13-F) or an oligonucleotide substantially identical thereto; and
(B) a second pair of codon 13 mutant oligonucleotide primers comprising
(i) a forward primer consisting of the nucleotide sequence represented by SEQ ID NO:7 (13ASP Forward Primer) or an oligonucleotide substantially identical thereto; and
(ii) a reverse primer consisting of the nucleotide sequence represented by SEQ ID NO:19 (C12 Common Reverse Primer) or an oligonucleotide substantially identical thereto.
13 . The method of claim 12 , wherein in step (1)(II), the at least one pair of mutant oligonucleotide primers comprises
(i) a reverse primer selected from (a) 13ASP Reverse Primer consisting of the nucleotide sequence represented by SEQ ID NO:1 or an oligonucleotide substantially identical thereto according to claim 1 , or (b) an oligonucleotide consisting of the nucleotide sequence represented by SEQ ID NO:4 (Kras38A — 3TG-R) or an oligonucleotide substantially identical thereto, and
(ii) a forward primer selected from (a) C13 Forward Primer consisting of the nucleotide sequence represented by SEQ ID NO:2 or an oligonucleotide substantially identical thereto according to claim 1 , or (b) an oligonucleotide consisting of the nucleotide sequence represented by SEQ ID NO:5 (KrasC13-F) or an oligonucleotide substantially identical thereto.
14 . The method of claim 13 , wherein the at least one pair of mutant oligonucleotide primers used in step (1)(II) comprises
(i) a 13ASP Reverse Primer consisting of the nucleotide sequence represented by SEQ ID NO:1 or an oligonucleotide substantially identical thereto, and
(ii) a C13 Forward Primer consisting of the nucleotide sequence represented by SEQ ID NO:2 or an oligonucleotide substantially identical thereto.
15 . The method of claim 13 , wherein the at least one pair of mutant oligonucleotide primers used in step (1)(II) comprises
(i) a reverse primer oligonucleotide consisting of the nucleotide sequence represented by SEQ ID NO:4 (Kras38A — 3TG-R) or an oligonucleotide substantially identical thereto, and
(ii) a forward primer an oligonucleotide consisting of the nucleotide sequence represented by SEQ ID NO:5 (KrasC13-F) or an oligonucleotide substantially identical thereto.
16 . The method of claim 11 , wherein in step (1)(II), the at least one pair of mutant oligonucleotide primers for codon 13 comprises
(i) a forward primer consisting of the nucleotide sequence represented by SEQ ID NO:7 (13ASP Forward Primer) or an oligonucleotide substantially identical thereto; and
(ii) a reverse primer consisting of the nucleotide sequence represented by SEQ ID NO:19 (C12 Common Reverse Primer) or an oligonucleotide substantially identical thereto.
17 . The method of claim 10 , wherein in step (2), the amplification product of the DNA region of exon 4 amplified by the pair of control oligonucleotide primers consists of the DNA region spanning from one member of the pair of control oligonucleotide primers to the other member of the pair of control oligonucleotide primers, or spanning from a region complementary to one member of the pair of control oligonucleotide primers to a region complementary to the other member of the pair of control oligonucleotide primers.
18 . The method of claim 10 , wherein in step (3), the amplification product of the DNA region of exon 2 amplified by the pair of mutant oligonucleotide primers consists of the DNA region spanning from one member of the at least one pair of mutant oligonucleotide primers to the other member of the at least one pair of mutant oligonucleotide primers, or spanning from a region complementary to one member of the at least one pair of mutant oligonucleotide primers to a region complementary to the other member of the at least one pair of mutant oligonucleotide primers.
19 . The method of claim 10 , wherein the thermostable DNA polymerase lacking 3′ exonuclease activity used in step (1) is selected from thermostable Bst DNA polymerase I isolated from Bacillus stearothermophilus , IsoTherm DNA polymerase, T7 DNA polymerase having the 3′ to 5′ exonuclease activity removed via oxidation of the amino acid residues essential for the exonuclease activity (Sequenase Version 1) or genetically by deleting 28 amino acids essential for the 3′ to 5′ exonuclease activity (Sequenase Version 2), Vent R (exo − ) DNA polymerase and Taq polymerase.
20 . The method of claim 19 , wherein the thermostable DNA polymerase lacking 3′ exonuclease activity is Taq polymerase.
21 . The method of claim 17 , wherein in step (2), the amplification product of the DNA region of exon 4 amplified by the pair of control oligonucleotide primers is determined with an oligonucleotide probe consisting of the nucleotide sequence represented by SEQ ID NO:13, or a labeled oligonucleotide substantially identical thereto.
22 . The method of claim 18 , wherein in step (2), the amplification product of the DNA region of exon 2 amplified by the at least one pair of mutant oligonucleotide primers is determined with an oligonucleotide probe consisting of the nucleotide sequence represented by SEQ ID NO:3 or 6, or a labeled oligonucleotide substantially identical thereto.
23 . The method of claim 22 , wherein in step (2), the amplification product of the DNA region of exon 2 amplified by the at least one pair of mutant oligonucleotide primers is determined with an oligonucleotide probe consisting of the nucleotide sequence represented by SEQ ID NO:3, or a labeled oligonucleotide substantially identical thereto.
24 . The method of claim 22 , wherein in step (2), the amplification product of the DNA region of exon 2 amplified by the at least one pair of mutant oligonucleotide primers is determined with an oligonucleotide probe consisting of the nucleotide sequence represented by SEQ ID NO:6, or a labeled oligonucleotide substantially identical thereto.
25 . The method of claim 14 , wherein in step (2), the amplification product of the DNA region of exon 2 amplified by the at least one pair of mutant oligonucleotide primers is determined with an oligonucleotide probe consisting of the nucleotide sequence represented by SEQ ID NO:3, or a labeled oligonucleotide substantially identical thereto.
26 . The method of claim 15 , wherein in step (2), the amplification product of the DNA region of exon 2 amplified by the at least one pair of mutant oligonucleotide primers is determined with an oligonucleotide probe consisting of the nucleotide sequence represented by SEQ ID NO:6, or a labeled oligonucleotide substantially identical thereto.
27 . The method of claim 1 , wherein the DNA used in step (1) is genomic DNA or cDNA obtained from a tissue.
28 . The method of claim 27 , wherein the DNA used in step (1) is cDNA obtained from a tissue.
29 . A method of predicting the sensitivity of a tumor in a patient to epidermal growth factor receptor-directed chemotherapy, comprising
(1) obtaining DNA from the tumor; and
(2) determining the presence of a mutation in codon 12 and/or a mutation in codon 13 in exon 2 of the KRAS gene in the DNA using the method of one of claims 10 - 28 for detecting a KRAS mutation in DNA, wherein the detection of the mutation in codon 12 and/or a mutation in codon 13 predicts that the tumor has reduced sensitivity toward epidermal growth factor receptor-directed chemotherapy compared with tumors of the same type having no mutation in codon 12 and codon 13.
30 . The method of claim 29 , wherein step (2) determines a mutation in codon 12 in exon 2 of the KRAS gene.
31 . The method of claim 29 , wherein step (2) determines a mutation in codon 13 in exon 2 of the KRAS gene.
32 . The method of claim 29 , wherein step (2) determines a mutation in codon 12 and a mutation in codon 13 in exon 2 of the KRAS gene.