Lipid binding nucleic acids

1. An L-nucleic acid molecule that binds sphingosine 1-phosphate, wherein the L-nucleic acid molecule comprises in 5′→3′ direction, (a) a first terminal stretch of nucleotides, a central stretch of nucleotides and a second terminal stretch of nucleotides, or (b) the second terminal stretch of nucleotides, the central stretch of nucleotides and the first terminal stretch of nucleotides, wherein the first terminal stretch of nucleotides comprises three to six nucleotides, and the second terminal stretch of nucleotides comprises three to six nucleotides, and the central stretch of nucleotides comprises

(SEQ ID NO: 43)

5′ AAUAGCCGUUGAAACGCCUUUAGAGAAGCACUAG 3′,

(SEQ ID NO: 44)

5′ AAUAGCCGAUGAAACGCCUUUAGAGAAGCACUAG 3′

or

(SEQ ID NO: 45)

5′ AAUAGCCGAAUGAAACGCCUUAAGAGAAGCACUAG 3′.

2. The L-nucleic acid molecule according to claim 1 , wherein the L-nucleic acid molecule is an antagonist of an activity mediated by sphingosine 1-phosphate.

3. The L-nucleic acid molecule according to claim 1 , wherein the first terminal stretch of nucleotides comprises 5′ X 1 X 2 X 3 SUG 3′ and the second terminal stretch of nucleotides comprises 5′ CASX 4 X 5 X 6 3′, wherein

a) X 1 is A, X 2 is G, X 3 is S, X 4 is S, X 5 is C, and X 6 is U;

b) X 1 is absent, X 2 is G, X 3 is S, X 4 is S, X 5 is C, and X 6 is U;

c) X 1 is A, X 2 is G, X 3 is S, X 4 is S, X 5 is C, and X 6 is absent; or

d) X 1 is absent, X 2 is G, X 3 is S, X 4 is S, X 5 is C, and X 6 is absent.

4. The L-nucleic acid molecule according to claim 1 , wherein

a) the first terminal stretch of nucleotides comprises 5′ AGCGUG 3′ and the second terminal stretch of nucleotides comprises 5′ CACGCU 3′; or

b) the first terminal stretch of nucleotides comprises 5′ GCGUG 3′ and the second terminal stretch of nucleotides comprises 5′ CACGC 3′.

5. The L-nucleic acid molecule according to claim 1 , wherein the first terminal stretch of nucleotides comprises 5′ X 1 X 2 X 3 SUG 3′ and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5′ CASX 4 X 5 X 6 3′, wherein

a) X 1 is absent, X 2 is absent, X 3 is S, X 4 is S, X 5 is C, and X 6 is absent;

b) X 1 is absent, X 2 is G, X 3 is S, X 4 is S, X 5 is absent, and X 6 is absent; or

c) X 1 is absent, X 2 is absent, X 3 is S, X 4 is S, X 5 is absent, and X 6 is absent.

6. The L-nucleic acid molecule according to claim 1 , wherein

a) the first terminal stretch of nucleotides comprises 5′ CGUG 3′ and the second terminal stretch of nucleotides comprises 5′ CACG 3′;

b) the first terminal stretch of nucleotides comprises 5′ GCUG 3′ and the second terminal stretch of nucleotides comprises 5′ CAGC 3′; or

c) the first terminal stretch of nucleotides comprises 5′ GGUG 3′ and the second terminal stretch of nucleotides comprises 5′ CACC 3′.

7. The L-nucleic acid molecule according to claim 1 , wherein the first terminal stretch of nucleotides comprises 5′ X 1 X 2 X 3 SUG 3′ and the second terminal stretch of nucleotides comprises 5′ CASX 4 X 5 X 6 3′, wherein X 1 is absent, X 2 is absent, X 3 is S or absent, X 4 is S or absent, X 5 is absent, and X 6 is absent.

8. The L-nucleic acid molecule according to claim 1 , wherein the first terminal stretch of nucleotides comprises 5′ GUG 3′ and the second terminal stretch of nucleotides comprises 5′ CAC 3′.

9. The L-nucleic acid molecule according to claim 1 , comprising a nucleotide sequence according to any one of SEQ ID NOs:12 to 26, 41 or 42, or a nucleic acid molecule at least 85% homologous thereto.

10. The L-nucleic acid molecule according to claim 1 , wherein the L-nucleic acid molecule comprises a modification group, wherein the L-nucleic acid molecule comprising the modification group gas a decreased excretion rate from an organism as compared to the nucleic acid not comprising the modification group; or the L-nucleic acid molecule comprising, the modification group has an increased retention time in an organism as compared to the nucleic acid molecule not comprising the modification group.

11. The L-nucleic acid molecule according to claim 10 , wherein the modification group is selected from the group consisting of a biodegradable modification and a non-biodegradable modification.

12. The L-nucleic acid of claim 10 , wherein the modification group is selected from the group consisting of polyethylene glycol, linear polyethylene glycol, branched polyethylene glycol, hydroxyethyl starch, a peptide, a protein, a polysaccharide, a sterol, polyoxypropylene, polyoxyamidate and poly (2-hydroxyethyl)-L-glutamine.

13. The L-nucleic acid molecule according to claim 10 , wherein the modification group comprises a linear polyethylene glycol or a branched polyethylene glycol comprising a molecular weight of 20,000 to about 120,000 Da, 30,000 to about 80,000 Da or about 40,000 Da.

14. The L-nucleic acid molecule according to claim 10 , wherein the modification group comprises hydroxyethyl starch comprising a molecular weight of from about 50 to about 1000 kDa, from about 100 to about 700 kDa or from 200 to 500 kDa.

15. The L-nucleic acid molecule according to claim 10 , wherein the modification group is coupled to the L-nucleic acid molecule via a biodegradable linker or a non-biodegradable linker.

16. A method comprising administering to a host suspected of a disease associated with sphingosine 1-phosphate, the L-nucleic acid molecule according to claim 1 .

17. The method according to claim 16 , wherein said L-nucleic acid inhibits angiogenensis, proliferation and/or fibrogenesis.

18. The method according to claim 16 , wherein said disease comprises an ocular disease.

19. The method of claim 16 , wherein said disease is selected from the group consisting of age-related macular degeneration, diabetic retinopathy with diabetic macular edema, retinal pigmented epithelium (RPE) detachment in age-related macular degeneration, RPE detachment in diabetic retinopathy, proliferative vitreoretinopathy, retinal fibrosis in age-related macular degeneration and retinal fibrosis in diabetic retinopathy.

20. The method according to claim 16 , wherein said disease comprises cancer.

21. The method of claim 16 , wherein said disease is selected from the group consisting of breast cancer, ovarian cancer, melanoma, lung cancer and hyperplasia.

22. The method according to claim 16 , wherein said disease comprises inflammation.

23. The method of claim 16 , wherein said disease is selected from the group consisting of an autoimmune disease, a pneumonia, sepsis and trauma.

24. The method according to claim 23 , wherein said disease is selected from the group consisting of multiple sclerosis, rheumatoid arthritis, psoriasis, asthma and inflammatory bowel disease.

25. A pharmaceutical composition comprising the L-nucleic acid molecule as defined in claim 1 and a pharmaceutically acceptable excipient, a pharmaceutically acceptable carrier, a pharmaceutically active agent or combinations thereof.

26. A complex comprising the L-nucleic acid molecule according to claim 1 and sphingosine 1-phosphate.

27. An L-nucleic acid molecule that binds sphingosine 1-phosphate, wherein the L-nucleic acid molecule is at least 85% homologous to a target L-nucleic acid molecule consisting of SEQ ID NO:18, wherein the L-nucleic acid molecule comprises ribonucleotides and at least one deoxyribonucleotide.

28. The L-nucleic acid molecule according to claim 27 , wherein the L-nucleic acid molecule comprises any one of SEQ ID NOs: 27 to 37, 39 or 40.

29. The L-nucleic acid molecule according to claim 27 , wherein the L-nucleic acid molecule comprises a modification group, wherein excretion rate of the L-nucleic acid molecule comprising the modification group from an organism is decreased as compared to the nucleic acid not comprising the modification group; or the L-nucleic acid molecule comprising the modification group has an increased retention time in an organism as compared to the nucleic acid molecule not comprising the modification group.

30. The L-nucleic acid molecule according to claim 29 , wherein the modification group is selected from the group consisting of a biodegradable modification and a non-biodegradable modification.

31. The L-nucleic acid of claim 29 , wherein the modification group is selected from the group consisting of polyethylene glycol, linear polyethylene glycol, branched polyethylene glycol, hydroxyethyl starch, a peptide, a protein, a polysaccharide, a sterol, polyoxypropylene, polyoxyamidate and poly (2-hydroxyethyly)-L-glutamine.

32. The L-nucleic acid molecule according to claim 29 , wherein the modification group comprises a linear polyethylene glycol or a branched polyethylene glycol comprising a molecular weight of 20,000 to about 120,000 Da, 30,000 to about 80,000 Da or about 40,000 Da.

33. The L-nucleic acid molecule according to claim 29 , wherein the modification group comprises hydroxyethyl starch comprising a molecular weight of from about 50 to about 1000 kDa, from about 100 to about 700 kDa or from 200 to 500 kDa.

34. The L-nucleic acid molecule according to claim 29 , wherein the modification group is coupled to the L-nucleic acid molecule via a biodegradable linker or a non-biodegradable linker.