Method for using probe based PCR detection to measure the levels of circulating demethylated β cell derived DNA as a measure of β cell loss in diabetes
A method for measuring blood levels of β cell DNA that is released upon β cell death by using a quantitative probe technology to detect amplified methylated and demethylated forms of the insulin gene DNA, representing normal tissue and β cell specific origin, respectively. Using probes permits the sensitive and specific identification of demethylated insulin DNA patterns that are present only in β cells. The method offers a bioassay for detecting β cell loss in diabetes, useful for screening of prediabetes, monitoring of disease progression, and selection and monitoring of therapies. The technique finds potential use in both Type I and Type II diabetes, as well as gestational diabetes.
1. A method for monitoring beta cell death, comprising:
extracting and purifying DNA from a body fluid of an animal or human;
treating the extracted purified DNA with bisulfite to convert demethylated cytosine to uracil while sparing the methylated cytosines;
amplifying the bisulfite-treated DNA using polymerase chain reaction;
purifying the amplified bisulfite-treated DNA;
providing methylation-status specific probes configured to measure, in a quantitative methylation-status sensitive probe hybridization reaction, demethylated insulin DNA of β cell origin and methylated insulin DNA of non-β cell origin, comprising:
a) at least one probe for detection of methylated insulin DNA of non-β cell origin selected from the group consisting of ACCTCCCGACGAATCT SEQ ID NO: 003 and TACCTCTCGTCGAATCT SEQ ID NO: 004; and
b) at least one probe for detection of demethylated insulin DNA of β cell origin selected from the group consisting of ACCTCCCAACAAATCT SEQ ID NO: 005 and TACCTCCCATCAAATCT SEQ ID NO: 006;
performing the quantitative methylation sensitive probe hybridization reaction on the purified bisulfite-treated DNA using the methylation-status specific probes; and
quantitatively analyzing relative amounts of methylated insulin DNA and demethylated insulin DNA.
2. The method according to claim 1 , wherein the polymerase chain reaction is conducted using a forward primer: GTGCGGTTTATATTTGGTGGAAGTT SEQ ID NO: 001 and a reverse primer: ACAACAATAAACAATTAACTCACCCTACAA SEQ ID NO: 002.
3. The method according to claim 1 , wherein the methylation-status specific probes are conjugated to a fluorophore.
4. The method according to claim 3 , wherein the fluorophore is 6-carboxy fluorescein.
5. The method according to claim 3 , wherein the fluorophore is tetrachlorofluorescein.
6. The method according to claim 3 , wherein each methylation-status specific probe comprises a quencher.
7. The method according to claim 6 , wherein the quencher is tetramethylrhodamine.
8. The method according to claim 4 , wherein the methylation-sensitive probe hybridization reaction comprises a quantitative release of a fluorophore from a probe bound to the purified bisulfite-treated DNA and wherein the quantitative analysis of the relative amounts of methylated insulin DNA and demethylated insulin DNA comprises monitoring the release of the fluorophore from the probe bound to the purified bisulfite-treated DNA.
9. The method according to claim 1 , wherein the body fluid is derived from blood, wherein the quantitative analysis statistically distinguishes between blood from a patient having type II diabetes and blood from a patient without diabetes.
10. A method for monitoring cell death of a cell type having at least one DNA portion that has a unique DNA CpG methylation-pattern as compared to other cells, the at least one DNA portion that has a unique DNA CpG methylation-pattern being released into body fluids upon cell death of cells of the cell type, comprising:
extracting and purifying DNA that comprises the DNA portion;
treating the extracted purified DNA with bisulfite to convert cytosine to uracil while sparing the CpG methylated cytosines;
amplifying a region of the bisulfite-treated DNA that comprises the DNA portion by polymerase chain reaction using DNA CpG methylation-pattern independent primers;
providing DNA CpG methylation-pattern specific probes configured to measure, in a quantitative DNA CpG methylation sensitive probe hybridization reaction, demethylated insulin DNA of β cell origin and CpG methylated insulin DNA of non-β cell origin, wherein the DNA CpG methylation pattern-specific probes comprise:
a) at least one probe for detection of methylated insulin DNA of non-β cell origin selected from the group consisting of ACCTCCCGACGAATCT SEQ ID NO: 003 and TACCTCTCGTCGAATCT SEQ ID NO: 004; and
b) at least one probe for detection of demethylated insulin DNA of β cell origin selected from the group consisting of ACCTCCCAACAAATCT SEQ ID NO: 005 and TACCTCCCATCAAATCT SEQ ID NO: 006;
performing a quantitative methylation sensitive probe hybridization reaction on the purified bisulfite-treated DNA using the DNA CpG methylation-pattern specific probes, wherein the probe for detection of demethylated insulin DNA of β cell origin measures the amount of the DNA portion having a unique DNA CpG methylation-pattern and the probe for detection of methylated insulin DNA of non-β cell origin measures the amount of the DNA portion lacking a unique DNA CpG methylation pattern;
quantitatively analyzing the relative amount of DNA portion having the unique DNA CpG methylation-pattern to DNA portion lacking the unique DNA CpG methylation pattern.
11. The method according to claim 10 , wherein the DNA portion having the unique DNA CpG methylation-pattern comprises an insulin gene from a pancreatic beta cell.
12. The method according to claim 10 , wherein the polymerase chain reaction is conducted using a DNA CpG methylation pattern-independent forward primer: GTGCGGTTTATATTTGGTGGAAGTT SEQ ID NO: 001 and a DNA CpG methylation pattern-independent reverse primer: ACAACAATAAACAATTAACTCACCCTACAA SEQ ID NO: 002.
13. The method according to claim 10 , wherein the DNA CpG methylation-pattern specific probes are conjugated to a fluorophore and a quencher.
14. The method according to claim 13 , wherein the quantitative methylation sensitive probe hybridization reaction comprises a quantitative release of the fluorophore from DNA CpG methylation-pattern specific probes and wherein the quantitative analysis of the relative amounts of the DNA portion having the unique DNA CpG methylation-pattern to the DNA portion lacking the unique DNA CpG methylation-pattern comprises monitoring the release of the fluorophore from the DNA CpG methylation-pattern specific probes bound to the purified bisulfite-treated DNA.
15. The method according to claim 13 , wherein in the methylation sensitive probe hybridization reaction, the binding of the DNA CpG methylation-pattern specific probes to a respective target sequence of the purified bisulfite-treated DNA causes a conformational change and alters the interaction of the fluorophore and quencher conjugated to said probes.
16. The method according to claim 10 , wherein the body fluid is derived from blood, the cell type having at least one DNA portion that has a unique DNA CpG methylation-pattern is a β cell, and the quantitative analysis statistically distinguishes between blood of a patient having type II diabetes and blood of a patient without diabetes.
17. A method for monitoring beta cell death, comprising: extracting and purifying genomic DNA from a body fluid of an animal or human, wherein the genomic DNA comprises at least a portion of a gene that is predominantly expressed by β cells and that contains a CpG methylation site;
treating the genomic DNA with bisulfite;
performing a polymerase chain reaction (PCR) with primers that flank a region of the genomic DNA that comprises the CpG methylation site;
purifying the PCR products;
melting the PCR products into single strands;
providing a first oligonucleotide probe capable of hybridizing with a target sequence that comprises a site corresponding to a bisulfite-converted CpG site and providing a second oligonucleotide probe capable of hybridizing with a target sequence that comprises a site corresponding to a bisulfite-nonconverted CpG site,
wherein the first and second oligonucleotide probes each comprise a non-FRET label pair consisting of a fluorophore and a quencher,
and wherein interaction of the first oligonucleotide probe or the second oligonucleotide probe with its respective target sequence causes a change from a first conformation to a second conformation, thereby changing the distance between the fluorophore and quencher of said label pair, and wherein in only one conformation do the fluorophore and quencher interact sufficiently to quench the fluorescence of the fluorophore by a predetermined amount;
hybridizing the single stranded PCR products with the first and second oligonucleotide probes,
wherein the first oligonucleotide probe is SEQ ID NO: 003 or SEQ ID NO: 004 and the second oligonucleotide probe is SEQ ID NO: 005 or SEQ ID NO: 006;
quantitatively measuring fluorescent signals emitted by the first oligonucleotide probe and emitted by the second oligonucleotide probe; and
reporting a quantitative relationship of the fluorescent signal emitted by the first oligonucleotide probe and the second oligonucleotide probe, indicative of the relative amount of β cell-derived DNA versus non-β cell-derived DNA.
18. The method according to claim 17 , wherein the primers used for the PCR are SEQ ID NO: 001 and SEQ ID NO: 002 respectively.
19. The method according to claim 17 , wherein the fluorophore is 6-carboxy fluorescein or tetrachlorofluorescein and the quencher is tetramethylrhodamine.
20. The method according to claim 17 , wherein the body fluid is derived from blood of a patient, wherein the relative amount of β cell-derived DNA versus non-β cell-derived DNA is capable of statistically distinguishing between blood from a patient having type II diabetes and blood from a normal patient.
21. A kit for detecting β cell-derived demethylated genomic DNA in a biological sample, wherein the kit comprises:
PCR primers that flank a portion of a gene that contains a target sequence that is selectively demethylated in β cells and contains at least one CpG methylation site;
a first oligonucleotide probe capable of hybridizing with the target sequence from β-cells on a PCR amplification product of bisulfite treated nucleic acids, wherein the target sequence contains at least one bisulfite-converted CpG methylation site of the portion of the gene; and
a second oligonucleotide probe capable of hybridizing with the target sequence from non-β-cells on a PCR amplification product of bisulfite treated nucleic acids, wherein the target sequence contains at least one bisulfite-nonconverted CpG methylation site of the portion of the gene,
wherein the first oligonucleotide probe comprises a fluorophore and is selected from the group consisting of ACCTCCCGACGAATCT SEQ ID NO: 003 and TACCTCTCGTCGAATCT SEQ ID NO: 004; and
wherein the second oligonucleotide probe comprises a fluorophore and is selected from the group consisting of ACCTCCCAACAAATCT SEQ ID NO: 005 and TACCTCCCATCAAATCT SEQ ID NO: 006.
22. The kit according to claim 21 , wherein the first and second oligonucleotide probes each further comprise a quencher, and wherein in a binding interaction of the first oligonucleotide probe with the bisulfite converted CpG methylation site of the target sequence, and the second oligonucleotide probe with the bisulfite non-converted CpG methylation site of the target sequence, a change from a first conformation to a second conformation occurs, thereby changing an interaction between the fluorophore and quencher of the respective probe, and wherein in only one conformation of the first and second conformations do the fluorophore and quencher interact sufficiently to quench the fluorescence of the fluorophore by at least 25 percent.
23. A method for monitoring beta cell death, comprising:
extracting and purifying DNA from a body fluid of an animal or human;
treating the extracted purified DNA with bisulfite to convert demethylated cytosine to uracil while sparing the methylated cytosines;
amplifying the bisulfite-treated DNA using polymerase chain reaction using insulin DNA-specific primers;
purifying the amplified bisulfite-treated DNA;
providing at least one of methylation-status specific probe configured to measure, in a quantitative methylation-status sensitive probe hybridization reaction, methylated insulin DNA of non-β cell origin, wherein the probe for detection of methylated insulin DNA of non-β cell origin is selected from the group consisting of ACCTCCCGACGAATCT SEQ ID NO: 003 and TACCTCTCGTCGAATCT SEQ ID NO: 004; and
providing at least one of methylation-status specific probe configured to measure, in a quantitative methylation-status sensitive probe hybridization reaction, demethylated insulin DNA of β cell origin, wherein the probe for detection of the demethylated insulin DNA of β cell origin is selected from the group consisting of ACCTCCCAACAAATCT SEQ ID NO: 005 and TACCTCCCATCAAATCT SEQ ID NO: 006;
performing the quantitative methylation sensitive probe hybridization reaction on the purified bisulfite-treated DNA using the methylation-status specific probes; and
quantitatively analyzing relative amounts of methylated insulin DNA and demethylated insulin DNA.