IP Library Granted Patent US 9,982,304
Granted Patent B2
US 9,982,304 · App. 13/819,933 · Granted May 29, 2018

ARID1A and PPP2R1A mutations in cancer

Inventors: Bert Vogelstein (Baltimore, MD); Kenneth W. Kinzler (Bel Air, MD); Victor Velculescu (Dayton, MD); Nickolas Papadopoulos (Towson, MD); Sian Jones (Baltimore, MD)
Assignee: The Johns Hopkins University
C12Q1/6886A61K31/7088A61K31/711G01N33/5011C12Q2600/156
View Patent ↗
Loading inventors, assignments & file history…
Monitor This Case
Get email alerts when status or documents change.
Order Certified Copies
Most orders are placed with the USPTO same day — all within 24 business hours.
Order via The Patent Place →
Pre-filled with this patent's details
Quick Facts
Patent No.
US 9,982,304
App. No.
13/819,933
Granted
May 29, 2018
Kind
B2
Abstract

Two genes, ARID1A (AT-rich interactive domain-containing protein 1A) and PPP2R1A (protein-phosphatase 2, regulatory subunit 1, alpha), can be used in methods which are useful for detecting cancer, diagnosing cancer, contributing to a diagnosis of cancer, confirming a diagnosis of cancer, identifying appropriate treatments for cancer, monitoring treatment of cancer, and evaluating treatment protocols for cancer, including ovarian clear cell carcinoma, breast cancer, colon cancer, gastric cancer, lung cancer, medulloblastoma, pancreatic cancer, and prostate cancer.

Claims (37)

1. A method, comprising:

amplifying coding regions of ARID1A gene or cDNA in a biological sample of an individual, wherein the biological sample comprises ovarian cells;

sequencing the amplified coding regions of ARID1A gene or cDNA;

detecting a mutation, wherein the mutation is a frameshift or a stop codon in the gene or cDNA.

2. The method of claim 1 , wherein the biological sample is selected from the group consisting of tissue, blood, serum, plasma, ascites, and urine.

3. The method of claim 1 , wherein the individual is suspected of having ovarian cancer.

4. The method of claim 1 , further comprising the step of obtaining the biological sample from the individual.

5. The method of claim 1 , wherein the biological sample is obtained by a method selected from the group consisting of culdocentesis, paracentesis, and biopsy.

6. The method of claim 1 wherein the mutation is hemizgyous in the ovarian cells.

7. The method of claim 1 wherein the mutation is 3854_3855insA.

8. The method of claim 4 , wherein the biological sample is obtained by a method selected from the group consisting of culdocentesis, paracentesis, and biopsy.

9. The method of claim 1 , wherein the individual is suspected of having ovarian clear cell carcinoma (OCCC).

10. The method of claim 1 , wherein the individual has endometriosis.

11. The method of claim 1 , wherein the individual has abdominal swelling due to ascites.

12. The method of claim 1 , wherein the mutation is a stop codon caused by a nonsense mutation.

13. The method of claim 1 wherein the mutation is a frameshift mutation caused by an insertion or a deletion.

14. The method of claim 1 wherein the mutation is selected from the group consisting of mutations:

c.3854_3855insA; c.553C>T; c.903_904dupGT;

c.3659_3684delTGATGGGGCGCATGTCCTATGAGCCA (SEQ ID NO:7), c.585C>A;

c.3391delC; c.4001_4002dupGCA (hom); c.6828_6829delTG(hom); c.1455_1466insCCTAC;

c.4926_4927insTGGC, c.4011_4012delTT (hom); c.4635G>A; c.5202T>A;

486_492delCGCCGCC (hom); c.3575delA; 3223delG; 6718dupG; c.898_899insCGTC;

c.6710_6711insT;1663C>T; c.782_791delCGTCGTCTTC (SEQ ID NO:8);

c.3634_3644delCAGCCCAGTAT (SEQ ID NO:9); c.1873C>T; c.2122C>T; 1804G>T; c.6702delT; c.1341T>G; c.3442delC; c.883dupC; c.2868delC; c.1881delT; and

c.2179_2188delCGGCCACCCA (SEQ ID NO:10) wherein the nucleotides are numbered by reference to SEQ ID NO: 2.

15. The method of claim 1 further comprising:

amplifying mononucleotide repeats in nucleic acids of a biological sample of the individual;

sizing the amplified mononucleotide repeats by electrophoresis.

16. A method, comprising:

testing and detecting in a biological sample of an individual a shortened ARIDIA protein, wherein the biological sample comprises proteins of ovarian cells of the individual which are contacted with an antibody reactive with the N-terminus of the ARID1A protein;

amplifying mononucleotide repeats in nucleic acids of a biological sample of the individual; and

sizing the amplified mononucleotide repeats by electrophoresis.

17. The method of claim 15 wherein the mononucleotide repeats are in an ARID1A gene.

18. The method of claim 16 wherein the mononucleotide repeats are in an ARID1A gene.

19. A method comprising:

amplifying mononucleotide repeats in an ARID1A gene in nucleic acids of a biological sample of an individual, wherein the biological sample comprises ovarian cells;

sizing the amplified mononucleotide repeats by electrophoresis.

Assignments (1)
ASSIGNMENT OF ASSIGNOR'S INTEREST Recorded Mar 4, 2013
From: VOGELSTEIN, BERT; KINZLER, KENNETH W.; VELCULESCU, VICTOR; PAPADOPOULOS, NICKOLAS; JONES, SIAN
To: THE JOHNS HOPKINS UNIVERSITY
Reel/Frame 029913/0385 →
Continuity (2)
Provisional Application 61379875 · Sep 3, 2010
Related Publication 20130210900A1 · Aug 15, 2013