Method for determining activators of excitatory synapse formation
The invention provides methods of screening a compound that can increase spine/excitatory synapse formation and/or numbers. The compound is identified by contacting Ephexin5 with a test compound and selecting the compounds that inhibit Rho GEF activity of Ephexin5. Additionally, the invention also provides methods for increasing spine/excitatory synapse formation and/or numbers by contacting a neuron with an Ephexin5 inhibitor.
1. A method of promoting spine-excitatory synapse formation, the method comprising decreasing the level of Ephexin5 or inhibiting the activity of Ephexin 5 in a neuron comprising contacting the neuron with an Ephexin5 inhibitor, wherein the inhibitor is a nucleic acid.
2. The method of claim 1 , wherein the nucleic acid is an antisense oligonucleotide, an aptamer, a siRNA, a shRNA, or a ribozym.
3. The method of claim 1 , wherein the nucleic acid is a shRNA comprising a nucleotide sequence selected from the group consisting of TAGCCGCCTTATGGATACAAA (SEQ ID NO: 11, Ephexin5 shRNA 5″), CCCTGCAGGACGAACCTTTAT (SEQ ID NO: 12, Ephexin5 shRNA 6″), and TCCGAAAGCACTTCCTCAAAT (SEQ ID NO: 13, Ephexin5 shRNA 7″).
4. The method of claim 1 , wherein said contacting is in vitro.
5. The method of claim 1 , wherein said activity is RhoA GEF activity of Ephexin5.