IMMUNOSTIMULATORY NUCLEIC ACID PACKAGED PARTICLES FOR THE TREATMENT OF HYPERSENSITIVITY

1 . A method of treating hypersensitivity in an animal, wherein said hypersensitivity is allergy or asthma, wherein said method comprises introducing a composition into said animal, and wherein said composition comprises:

(a) a virus-like particle of an RNA bacteriophage; and

(b) an unmethylated CpG-containing oligonucleotide;

wherein said virus-like particle of an RNA bacteriophage is packaged with said unmethylated CpG-containing oligonucleotide, and wherein said method does not comprise co-administering an allergen to said animal, and wherein introduction of said composition treats said hypersensitivity in said animal.

2 - 6 . (canceled)

7 . The method of claim 1 , wherein said virus-like particle of an RNA bacteriophage comprises coat proteins, or fragments thereof, of an RNA bacteriophage.

8 . The method of claim 1 , wherein said RNA bacteriophage is selected from the group consisting of:

(a) bacteriophage Qβ;

(b) bacteriophage R17;

(c) bacteriophage fr;

(d) bacteriophage GA;

(e) bacteriophage SP;

(f) bacteriophage MS2;

(g) bacteriophage M11;

(h) bacteriophage MX1;

(i) bacteriophage NL95;

(j) bacteriophage f2;

(k) bacteriophage PP7; and

(l) bacteriophage AP205.

9 - 19 . (canceled)

20 . The method of claim 1 , wherein said unmethylated CpG containing oligonucleotide is capable of stimulating IFN-alpha production in a cell.

21 - 24 . (canceled)

25 . The method of claim 1 , wherein said unmethylated CpG-containing oligonucleotide comprises a palindromic sequence.

26 . The method of claim 1 , wherein the CpG motif of said unmethylated CpG-containing oligonucleotide is part of a palindromic sequence.

27 . The method of claim 26 , wherein said palindromic sequence is GACGATCGTC (SEQ ID NO:28).

28 . The method of claim 25 , wherein said palindromic sequence is flanked at its 5′-terminus and at its 3′-terminus by guanosine entities.

29 . The method of claim 25 , wherein said palindromic sequence is flanked at its 5′-terminus by at least 3 and at most 15 guanosine entities, and wherein said palindromic sequence is flanked at its 3′-terminus by at least 3 and at most 15 guanosine entities.

30 . The method of claim 1 , wherein said unmethylated CpG-containing oligonucleotide comprises the sequence selected from the group consisting of:

(SEQ ID NO: 32)

(a) “G6-6” GGGGGGGACGATCGTCGGGGGG;

(SEQ ID NO: 33)

(b) “G7-7” GGGGGGGGACGATCGTCGGGGGGG; 

(SEQ ID NO: 25)

(c) “G8-8” GGGGGGGGGACGATCGTCGGGGGGGG;

(SEQ ID NO: 26)

(d) “G9-9” GGGGGGGGGGACGATCGTCGGGGGGGGG;

and

(SEQ ID NO: 27)

(e) “G10” GGGGGGGGGGGACGATCGTCGGGGGGGGGG.

31 . The method of claim 1 , wherein said unmethylated CpG-containing oligonucleotide comprises the sequence

(SEQ ID NO: 27)

GGGGGGGGGG GACGATCGTC GGGGGGGGGG.

32 . The method of claim 1 , wherein said unmethylated CpG-containing oligonucleotide consists exclusively of phosphodiester bound nucleotides.

33 - 39 . (canceled)

40 . The method of claim 1 , wherein said hypersensitivity is asthma.

41 . The method of claim 40 , wherein said asthma is IgE-mediated asthma.

42 - 53 . (canceled)

54 . The method of claim 1 , wherein said animal is a human.

55 . (canceled)

56 . (canceled)

57 . The method of claim 1 , wherein said method does not comprise introducing to said animal.

58 . (canceled)

59 . (canceled)

60 . The method of claim 1 wherein an allergen is not introduced in said animal for at least one week before and at least one week after said introduction of said composition in said animal.

61 . (canceled)

62 . The method of claim 1 , wherein an allergen is not introduced in said animal for at least eight weeks before and at least eights weeks after said introduction of said composition in said animal.

63 - 79 . (canceled)

80 . The method of claim 1 , wherein said virus-like particle of an RNA bacteriophage essentially consists of coat proteins having the amino acid sequence of SEQ ID NO:3.

81 . The method of claim 1 , wherein said composition does not comprise an allergen.