Method and compositions comprising small RNA agonist and antagonists to modulate inflammation
View Patent ↗The disclosure provides methods and compositions for modulating inflammation.
1. A composition comprising a nucleotide sequence selected from the group consisting of:
(i) loop “a” of U1 snRNA consisting of GGGAGAACCAUGAUCACGAAGGUGGUUUUCCC (SEQ ID NO:2);
(ii) loop “b” of U1 snRNA consisting of GGGCGAGGCUUAUCCAUUGCACUCCGGAUGUGCUGACCCC (SEQ ID NO:3);
(iii) a fragment of a loop “c” of U1 snRNA consisting of 10-26 nucleotides of CGAUUUCCCCAAAUGUGGGAAACUCG (SEQ ID NO:4);
(iv) any of the foregoing sequences wherein U is T;
(v) complements of any of the foregoing sequences;
(vi) any of the foregoing sequences comprising a non-natural nucleotide; and
(vii) an oligonucleotide having 99% identity with any of the foregoing sequences wherein the oligonucleotide can stimulate IL-6 and/or TNF α production in a mammalian cell,
wherein the nucleotide sequence is chemically linked to a charge neutralizing agent and wherein the composition comprises a pharmaceutically acceptable carrier.
2. A method of inducing inflammation comprising contacting a tissue with a composition of claim 1 , wherein the composition induces TNF-alpha and/or IL-6 production.
3. A method of treating an infection in a subject comprising contacting a tissue with a composition of claim 1 , wherein the composition induces TNF-alpha and/or IL-6 production.
4. The method of claim 3 , wherein the infection is a skin infection.
5. A method of treating a skin wound comprising contacting a tissue with a composition of claim 1 , wherein the composition induces TNF-alpha and/or IL-6 production.