Dosage compensating transgenes and cells
Methods and compositions for reducing expression of genes on Chromosome 21 (“Chr 21”) by targeting an XIST transgene to the Dual specificity tyrosine-phosphorylation-regulated kinase 1A (DYRK1A) gene or a Regulator of calcineurin 1 (RCAN1) gene, and cells and transgenic animals comprising an XIST transgene inserted into a DYRK1A or RCAN1 allele, e.g., cells and animals trisomic for human Chr 21 and mouse Chr 16.
1. A silencing vector comprising:
a silencing element comprising a silencing sequence flanked by first and second targeting sequences, wherein the first and second targeting sequences target a sequence within intron 1 of the dual specificity tyrosine-phosphorylation-regulated kinase 1A (DYRK1A) gene comprising GCCACCCCTTTGCCAGTTTACACGGGTGATGAGCAGGCTGTT (SEQ ID NO: 11), wherein the first targeting sequence consists of SEQ ID NO:12 or 14, and/or the second targeting sequence consists of SEQ ID NO:13 or 15; and
a promoter operably linked to the silencing element.
2. The silencing vector of claim 1 , wherein the vector is a plasmid or a viral vector.
3. The silencing vector of claim 2 , wherein the viral vector is vaccinia virus, adeno-associated virus (MV), or herpes virus.
4. The silencing vector of claim 1 , wherein the silencing element comprises a human X inactive specific transcript (XIST) cDNA or functional fragment thereof.
5. The silencing vector of claim 4 , further comprising a selectable marker sequence.
6. The silencing vector of claim 5 , wherein the selectable marker sequence is operably linked to a promoter.
7. A silencing vector comprising SEQ ID NO: 45, 54, or 56.
8. A method of reducing levels of expression of genes on Chromosome 21 in a cell, the method comprising contacting the cell with the silencing vector of claim 1 , under conditions sufficient for the silencing vector to undergo homologous recombination with the genomic DNA of the cell, wherein the silencing element is inserted into intron 1 of DYRK1A.
9. The method of claim 8 , wherein the cell is trisomic for chromosome 21.
10. The method of claim 8 , wherein the cell is a human cell.
11. The method of claim 10 , wherein the cell is a stem cell or a fibroblast.
12. The method of claim 11 , wherein the stem cell is an induced pluripotent stem cell (iPSC), a hematopoietic stem cell, or a neural stem cell.
13. An isolated cell produced by the method of claim 8 .
14. A method of reducing the risk of transient myeloproliferative disorder (TMD) in a subject who has Down Syndrome (Trisomy 21), the method comprising:
obtaining a hematopoietic stem cell from the subject;
contacting the cell with the silencing vector of claim 1 , under conditions sufficient for the silencing vector to undergo homologous recombination with the genomic DNA of the cell, wherein the silencing element is inserted into DYRK1A, to produce a modified cell having reduced levels of expression of genes on Chromosome 21; and
administering the modified cell to the subject.
15. The method of claim 8 , further comprising contacting the cell with a cleavage vector comprising a sequence that enhances or facilitates homologous recombination.
16. The method of claim 15 , wherein the cleavage vector comprises a zinc finger nuclease (ZFN) or a transcription activator-like effector nuclease (TALEN).
17. The method of claim 15 , wherein the cleavage vector comprises SEQ ID NO: 45, 54, or 56.