Genetically enhanced cyanobacteria for the production of a first chemical compound harbouring Zn
One embodiment of the invention is directed to a genetically enhanced cyanobacterium for the production of a first chemical compound, comprising at least one first recombinant gene encoding a first biocatalyst for the production of the first chemical compound, wherein the gene is under the transcriptional control of a Co 2+ or Zn 2+ -inducible promoter. Such a cyanobacterium can provide a tighter control of the production of the first chemical compound.
1. An ethanologenic recombinant cyanobacterium comprising a recombinant alcohol dehydrogenase gene and a heterologous pyruvate decarboxylase gene wherein said alcohol dehydrogenase gene is operably linked to a first promoter and wherein said pyruvate decarboxylase gene is operably linked to a second promoter and wherein said second promoter is a Co2+ inducible promoter or a Zn2+ inducible promoter.
2. The ethanologenic recombinant cyanobacterium of claim 1 wherein said first promoter is a Co2+ inducible promoter or a Zn2+ inducible promoter.
3. The ethanologenic recombinant cyanobacterium of claim 1 wherein said first promoter is constitutive.
4. The ethanologenic recombinant cyanobacterium of claim 3 wherein said first promoter is PrbcL.
5. The ethanologenic recombinant cyanobacterium of claim 1 wherein said second promoter is selected from the group consisting of PziaA from Synechocystis 6803, PsmtA from Synechococcus 7942 and Synechococcus 7002, PcorT from Synechocystis 6803, PaztA from Anabaena 7120, PbmtA from Oscillatoria brevis , Pbxa1 from Oscillatoria brevis , PzntA from Staphylococcus aureus , PczrB from Staphylococcus aureus 912, and PnmtA from Mycobacterium tuberculosis.
6. The ethanologenic recombinant cyanobacterium of claim 1 , further comprising an extrachromosomal plasmid either comprising a first promoter, recombinant alcohol dehydrogenase gene, second promoter, and heterologous pyruvate decarboxylase gene, or comprising a second promoter and a heterologous pyruvate decarboxylase gene.
7. The ethanologenic recombinant cyanobacterium of claim 1 wherein said second promoter is inducible by Zn2+.
8. The ethanologenic recombinant cyanobacterium of claim 7 wherein said second promoter has a sequence that is at least 70% identical to the sequence of a ziaA promoter having the sequence of:
(SEQ ID NO. 5)
(N) 11 AATATCTGAGCATATCTTCAGGTGTT(N) 13 TACGGT(N) 6 A
(N) 16 ACGTTGGCCGCCATG,
wherein each of said N nucleotides is selected from a group consisting of A, T, C and G and wherein said 3′ATG is the start codon of said heterologous pyruvate decarboxylase gene.
9. The ethanologenic recombinant cyanobacterium of claim 7 wherein said second promoter has a sequence that is at least 70% identical to the sequence of a aztA promoter having the sequence of:
(SEQ ID NO. 44)
(N) 12 TGTACAATTGAATAGTTGTTCAATTGTTGTATTAGAAT
(N) 5 C(N) 17 AATTCTAAAGCTGCTATG,
wherein each of said N nucleotides is selected from a group consisting of A, T, C and G and wherein said 3′ATG is the start codon of said heterologous pyruvate decarboxylase gene.
10. The ethanologenic recombinant cyanobacterium of claim 1 wherein said second promoter is inducible by Co2+.
11. The ethanologenic recombinant cyanobacterium of claim 10 wherein said second promoter has a sequence that is at least 70% identical to the sequence of a corT promoter having the sequence of:
(SEQ IS NO. 31)
CAT(N) 7 GTTTACTCAAAACCTTGACATTGACACTAATGTTAAGGTTTA
GGCT(N) 15 CAAGTTAAAAAGCATG,
wherein each of said N nucleotides is selected from a group consisting of A, T, C and G and wherein said 5′ CAT is the start codon of a corR gene in the antisense orientation, and wherein said 3′ATG is the start codon of said heterologous pyruvate decarboxylase gene.
12. An ethanologenic recombinant cyanobacterium comprising a recombinant alcohol dehydrogenase gene and a heterologous pyruvate decarboxylase gene wherein said alcohol dehydrogenase gene is operably linked to a first promoter and wherein said pyruvate decarboxylase gene is operably linked to a second promoter and wherein said second promoter is a Ni2+ inducible promoter.
13. The ethanologenic recombinant cyanobacterium of claim 12 wherein said first promoter is a Ni2+ inducible promoter.
14. The ethanologenic recombinant cyanobacterium of claim 12 wherein said first promoter is constitutive.
15. The ethanologenic recombinant cyanobacterium of claim 14 wherein said first promoter is PrbcL.
16. The ethanologenic recombinant cyanobacterium of claim 12 wherein said second promoter is selected from the group consisting of nrsRS-PnrsB from Synechocystis PCC 6803 and nrsRS916-PnrsB916 from Synechococcus sp.
17. The ethanologenic recombinant cyanobacterium of claim 12 wherein said second promoter inducible by Ni2+ has a sequence that is at least 70% identical to the sequence of a nrsB promoter having the sequence of:
(SEQ ID NO. 91)
(N) 14 GAGATTTTCACCTGAATTTCATACCCCCTTTGGCAGACTGGGAAA
(N) 17 AATTTGAGGTGGTGTGATG,
wherein each of said N nucleotides is selected from a group consisting of A, T, C and G and wherein said 3′ATG is the start codon of said heterologous pyruvate decarboxylase gene.
18. The ethanologenic recombinant cyanobacterium of claim 11 wherein said second promoter inducible by Ni2+ has a sequence that is at least 70% identical to the sequence of a nrsB promoter having the sequence of:
(SEQ ID NO. 92)
(N) 14 GCCTATTTCACTTAGATTTCATACCCCCTCTGGCAAACTGGAAA
AA(N) 24 AATGTGAGGTGCTGTGATG,
wherein each of said N nucleotides is selected from a group consisting of A, T, C and G and wherein said 3′ATG is the start codon of said heterologous pyruvate decarboxylase gene.