Gene-targeted apoptosis
Described herein are methods of triplex-induced apoptosis, in which multiple triplexes are formed in cells in which gene amplification has occurred (cells comprising/characterized by at least one amplified gene), referred to as target cells, and apoptosis is induced in the target cells.
1. A method of inducing apoptosis in breast cancer cells in which the HER2 gene is amplified, the method comprising contacting breast cancer cells in which the HER2 gene is amplified with
(a) triplex inducing oligonucleotides (TFOs) specific for a polypurine site in the amplified HER2 gene and (b) a transport peptide, under conditions under which the TFOs and the transport peptide enter the breast cancer cells and the TFOs enter the breast cancer cells in sufficient quantity to induce apoptosis.
2. A method of inducing apoptosis in breast cancer cells comprising an amplified HER2 gene, the method comprising contacting breast cancer cells comprising an amplified HER2 gene with
(a) triplex forming oligonucleotides (TFOs), specific for a polypurine site in the amplified HER2 gene and (b) a transport peptide, under conditions under which the TFOs and the transport peptides enter the breast cancer cells comprising amplified HER2 gene and TFOs enter the breast cancer cells comprising amplified HER2 gene in sufficient quantity, bind multiple polypurine site(s) in the amplified HER2 gene and form multiple triplexes in the cells and induce apoptosis.
3. The method of claim 1 , wherein the TFOs and the transport peptides are linked, either covalently or non-covalently.
4. The method of claim 1 , wherein the TFOs and the transport peptides are not linked and are contacted with the breast cancer cells as a mixture.
5. The method of claim 1 , wherein the breast cancer cells in which the HER2 gene is amplified are resistant to Herceptin.
6. The method of claim 2 , wherein the TFOs and the transport peptides are linked, either covalently or non-covalently.
7. The method of claim 2 , wherein the TFOs and the transport peptides are not linked and are contacted with the breast cancer cells as a mixture.
8. The method of claim 2 , wherein the breast cancer cells comprising an amplified HER2 gene are resistant to Herceptin.
9. The method of claim 1 , wherein the TFOs comprise 5′GAGGAGGAGTGGGAGAATGGGGGG (SEQ ID NO: 16).
10. The method of claim 9 , wherein the transport peptide comprises a cationic cell-penetrating peptide.
11. The method of claim 1 , wherein the TFOs comprise 5′GAGGAGGAGTGGGAGAATGGGGGG (SEQ ID NO: 16) and the transport peptide comprises a peptide selected from the group consisting of: Penetratin or Antenapedia (RQIKIWFQNRRMKWKK (SEQ ID NO: 1), PTD RQIKWFQNRRMKWKK (SEQ ID NO: 2); HIV TAT protein (YGRKKRRQRRR (SEQ ID NO: 3); SynB1 (RGGRLSYSRRRFSTSTGR (SEQ ID NO: 4); SynB3 (RRLSYSRRRF (SEQ ID NO: 5); PTD-4 (PIRRRKKLRRLK (SEQ ID NO: 6); PTD-5 (RRQRRTSKLMKR (SEQ ID NO: 7); FHV Coat-(35-49) (RRRRNRTRRNRRRVR (SEQ ID NO: 8); BMV Gag-(7-25) (KMTRAQRRAAARRNRWTAR (SEQ ID NO: 9); HTLV-II Rex-(4-16) (TRRQRTRRARRNR (SEQ ID NO: 10); D-Tat (GRKKRRQRRRPPQ (SEQ ID NO: 11); and R9-Tat (GRRRRRRRRRPPQ (SEQ ID NO: 12).
12. The method of claim 2 , wherein the TFOs comprise 5′GAGGAGGAGTGGGAGAATGGGGGG (SEQ ID NO: 16).
13. The method of claim 12 , wherein the transport peptide comprises a cationic cell-penetrating peptide.
14. The method of claim 2 , wherein the TFOs comprise: 5′GAGGAGGAGTGGGAGAATGGGGGG (SEQ ID NO: 16 and the transport peptide comprises a peptide selected from the group consisting of: Penetratin or Antenapedia (RQIKIWFQNRRMKWKK (SEQ ID NO: 1), PTD RQIKWFQNRRMKWKK (SEQ ID NO: 2); HIV TAT protein (YGRKKRRQRRR (SEQ ID NO: 3); SynB1 (RGGRLSYSRRRFSTSTGR (SEQ ID NO: 4); SynB3 (RRLSYSRRRF (SEQ ID NO: 5); PTD-4 (PIRRRKKLRRLK (SEQ ID NO: 6); PTD-5 (RRQRRTSKLMKR (SEQ ID NO: 7); FHV Coat-(35-49) (RRRRNRTRRNRRRVR (SEQ ID NO: 8); BMV Gag-(7-25) (KMTRAQRRAAARRNRWTAR (SEQ ID NO: 9); HTLV-II Rex-(4-16) (TRRQRTRRARRNR (SEQ ID NO: 10); D-Tat (GRKKRRQRRRPPQ (SEQ ID NO: 11); and R9-Tat (GRRRRRRRRRPPQ (SEQ ID NO: 12).