RNA-interference-inducing nucleic acid molecule able to penetrate into cells, and use therefor
Provided herein are RNAi-inducing double-stranded nucleic acid molecules having cell penetrating ability and targeting mRNA encoding a connective tissue growth factor (CTGF). In certain embodiments, the RNAi-inducing double-stranded nucleic acid molecule comprises a first strand of having a sequence of UCUUCCAGUCGGUAAGCCGCGAGGGCAGGCC and comprising 4 to 17 phosphorothioate bonds and at least one 2′-O-Me modified nucleotide, as well as a second strand having a sequence of CUUACCGACUGGAAGA and comprising at least one phosphorothioate bond and at least one 2′-O-Me modified nucleotide and further comprising a cholesterol moiety covalently attached to its 3′ end.
1. An RNAi-inducing double-stranded nucleic acid molecule comprising:
a first strand having a nucleotide sequence consisting of the nucleotide sequence of SEQ ID NO: 154 and comprising 4 to 17 phosphorothioate bonds and at least one 2′-O-Me modified nucleotide; and
a second strand having a nucleotide sequence consisting of the nucleotide sequence of SEQ ID NO: 153 and comprising at least one phosphorothioate bond and at least one 2′-O-Me modified nucleotide and further comprising a cholesterol moiety covalently attached to its 3′ end;
wherein the second strand binds to the first strand such that the first strand has a double-stranded region to which the second strand binds and a single-stranded region to which the second strand does not bind, and wherein the 5′ end of the first strand and the 3′ end of the second strand form a blunt end.
2. The nucleic acid molecule of claim 1 , wherein at least one of the nucleotides of the single-stranded region in the first strand comprises a deoxyadenosine derivative having a phenyl group.
3. A gene-silencing composition comprising the nucleic acid molecule according to claim 1 and a pharmaceutically acceptable carrier, excipient or diluent.
4. The nucleic acid molecule of claim 1 , wherein the first strand comprises 7 to 12 phosphorothioate bonds.
5. The nucleic acid molecule of claim 1 , wherein the 4 to 17 phosphorothioate bonds are the 4 to 17 internucleotide bonds located closest to the 3′ end of the first strand of the nucleic acid molecule.
6. The nucleic acid molecule of claim 4 , wherein the 7 to 12 phosphorothioate bonds are the 7 to 12 internucleotide bonds located closest to the 3′ end of the first strand of the nucleic acid molecule.
7. The nucleic acid molecule of claim 1 , wherein the first strand comprises 2′-O-Me modified nucleotides at positions 1, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29 and 31 of SEQ ID NO: 154.
8. The nucleic acid molecule of claim 1 , wherein the second strand comprises 2′-O-Me modified nucleotides at positions 1, 3, 5, 7, 9, 11, 13 and 15 of SEQ ID NO: 153.
9. The nucleic acid molecule of claim 7 , wherein the second strand comprises 2′-O-Me modified nucleotides at positions 1, 3, 5, 7, 9, 11, 13 and 15 of SEQ ID NO: 153.
10. The nucleic acid molecule of claim 1 , wherein the second strand comprises three phosphorothioate bonds.
11. The nucleic acid molecule of claim 10 , wherein the cholesterol moiety is covalently attached to the 3′ end of the second strand by an additional phosphorothioate bond.
12. The nucleic acid molecule of claim 11 , wherein the three phosphorothioate bonds are the two internucleotide bonds located closest to the 3′ end of the second strand of the nucleic acid molecule and the covalent bond that attaches the cholesterol moiety to the 3′ end of the second strand of the nucleic acid molecule.
13. The nucleic acid molecule of claim 9 , wherein the second strand comprises three phosphorothioate bonds.
14. The nucleic acid molecule of claim 13 , wherein the cholesterol moiety is covalently attached to the 3′ end of the second strand by an additional phosphorothioate bond.
15. The nucleic acid molecule of claim 14 , wherein the three phosphorothioate bonds are the two internucleotide bonds located closest to the 3′ end of the second strand of the nucleic acid molecule and the covalent bond that attaches the cholesterol moiety to the 3′ end of the second strand of the nucleic acid molecule.