Inhibitors of microRNAs that regulate production of atrial natriuretic peptide (ANP) as therapeutics and uses thereof
The present invention relates to methods, kits and compositions to treat hypertension and other cardiovascular diseases in a subject, in particular, a method of treating or preventing a cardiovascular disease in a subject comprising administering to a subject at least one anti-miR agent to miRNA-425. In some embodiments, an anti-miR agent is a small molecule or an oligonucleotide complementary to at least part of the miR-425 of SEQ ID NO: 1, or an anti-miR complementary to at least part of the miRNA seed sequence AUGACA (SEQ ID NO: 2). Another aspect of the present invention relates to methods, kits and compositions to treat low blood pressure in a subject comprising administering a composition comprising a miR-425 agent to decrease ANP levels in the subject. Other aspects of the present invention relates to assays, methods and systems to identify a subject at risk of hypertension, or identifying a subject suitable to administration of an anti-miR-425 agent for treatment of hypertension, the assay comprising assessing if a subject is homozygous or heterozygous for the major (A) allele of rs5068 SNP, and/or assaying for levels of miR-425 and/or assaying for levels of NT-proANP and/or levels of ANP in the plasma of a subject.
1. A method for treating a subject with hypertension, the method comprising administering to the subject an effective amount of nucleic acid inhibitor of miRNA-425 activity, wherein the subject is determined to be homozygous (AA) or heterozygous (AG) for A allele for the single nucleotide polymorphism (SNP) rs5068 (A/G).
2. The method of claim 1 , wherein the nucleic acid inhibitor comprises a nucleotide sequence that is at least 75% complementary to the nucleic acid sequence GAAAGCGCUUUGGAAUGACACGAUCACUCCCGUUGAGUGGGCACCCGAGAAGCCAUCGGGAA UGUCGUGUCCGCCCAGUGCUCUUUC (SEQ ID No: 13).
3. The method of claim 1 , wherein the nucleic acid inhibitor comprises a nucleotide sequence that is at least 75% complementary to the nucleic acid sequence AAUGACACGAUCACUCCCGUUGA (SEQ ID NO: 1).
4. The method of claim 1 , wherein the nucleic acid inhibitor comprises a nucleotide sequence that is complementary to nucleic acid sequence AUGACA (SEQ ID NO: 2).
5. The method of claim 1 , wherein the nucleic acid inhibitor comprises the nucleotide sequence TTACTGTGCTAGTGAGGGCAACT (SEQ ID NO: 3).
6. The method of claim 1 , further comprising selecting the subject for treatment for hypertension before onset of said administering, comprising assaying a biological sample from the subject for single nucleotide polymorphism of SNP rs5068 (A/G) and selecting the subject who is homozygous for A allele of SNP rs5068 (A/G).
7. The method of claim 1 , further comprising co-administering a therapeutic agent, wherein the therapeutic agent is for treatment of hypertension.
8. A method of treating a subject with hypotension, the method comprising administering to the subject an effective amount of a miR-425 miRNA or RNAi molecule effective at binding to the miRNA target sequence of 5′ATGACAC-3′ (SEQ ID NO: 8) or 5′GTGACAC-3′ (SEQ ID NO: 9) in the 3′UTR of the NPPA gene, and wherein the subject is determined to heterozygous or homozygous for A allele for the single nucleotide polymorphism (SNP) rs5068 (A/G).
9. The method of claim 8 , wherein the miR-425 miRNA comprises a nucleotide sequence that has at least 85% sequence identity to the nucleic acid sequence of: GAAAGCGCUUUGGAAUGACACGAUCACUCCCGUUGAGUGGGCACCCGAGAAGCCAUCGGGAA UGUCGUGUCCGCCCAGUGCUCUUUC (SEQ ID No. 13).
10. The method of claim 8 , wherein the miR-425 miRNA comprises a nucleotide sequence that has at least 85% sequence identity to the nucleic acid sequence of: AAUGACACGAUCACUCCCGUUGA (SEQ ID NO: 1).
11. The method of claim 8 , wherein the miR-425 miRNA comprises the nucleic acid sequence AUGACA (SEQ ID NO:2).
12. The method of claim 8 , further comprising selecting the subject for treatment for inhibiting angiogenesis or preventing or inhibiting orthostatic hypotension before onset of said administering, comprising assaying a biological sample from the subject for single nucleotide polymorphism of SNP rs5068 (A/G) and selecting the subject who is heterozygous or homozygous for A allele of SNP rs5068 (A/G).
13. The method of claim 8 , further comprising co-administering a therapeutic agent, wherein the therapeutic agent is for treatment for inhibiting angiogenesis or orthostatic hypotension.