Compositions and methods for sensitizing a neoplastic cell to radiation
The invention provides for the use of radiation sensitizing agents in combination with radiation for the treatment of neoplasia, methods for the identification of genotype-specific radiation sensitizing agents, and methods of identifying patients who could benefit from therapy with a genotype-specific radiation sensitizing agent.
1. A method of sensitizing a non small cell lung cancer cell to radiation, the method comprising contacting the cell with a PI3 kinase inhibitor and exposing the cell to radiation, thereby sensitizing the cell to radiation, wherein the cell comprises a NFE2L2 mutation.
2. A method of enhancing cell death or reducing proliferation in a non small cell lung cancer cell, the method comprising contacting the cell with a PI3 kinase inhibitor and exposing the cell to radiation, thereby enhancing cell death or reducing proliferation in said cell, wherein the cell comprises a NFE2L2 mutation.
3. A method of enhancing radiation sensitivity in a subject having a radiation-resistant non small cell lung cancer, the method comprising administering to the subject radiation and a PI3 kinase inhibitor, thereby enhancing the subject's sensitivity to radiation, wherein radiation resistance is characterized by detecting a NFE2L2 mutation associated with radiation resistance.
4. The method of claim 3 , wherein the radiation-susceptibility of the non small cell lung cancer is characterized prior to, during, or following administration of radiation.
5. The method of claim 4 , wherein the radiation-susceptibility is characterized by assaying for NRF2 activation or TP53 activation.
6. The method of claim 4 , wherein radiation resistance is characterized by detecting a TP53 mutation in the subject, wherein a TP53 missense mutation identifies the neoplasia as radiation resistant and a TP53 disruptive mutation identifies the neoplasia as radiation sensitive.
7. The method of claim 5 , wherein the radiation susceptibility is characterized by assaying a TP53 DNA binding domain (aa. 101-305) for mutations.
8. The method of claim 5 , wherein the radiation susceptibility is characterized by detecting a TP53 mutation selected from the group consisting of W146*, E171*, Q167*, E298*, V143A, D259V, R249S, M237I, V272M, V143M, R248W, and R158G Intron (ins).
9. The method of claim 4 , wherein the NFE2L2 mutation is D77V, P128L, or E79K.
10. The method of claim 1 , wherein the PI3 kinase inhibitor is a PI3K alpha selective inhibitor.
11. The method of claim 10 , wherein the PI3 kinase inhibitor is LY 294002 or NVP-BKM120.
12. The method of claim 1 , wherein the PI3 kinase inhibitor is an inhibitory nucleic acid that reduces NRF2 expression.
13. The method of claim 12 , wherein the inhibitory nucleic acid molecule is NRF2-1 shRNA, AGAGCAAGATTTAGATCATTT (SEQ ID NO: 1) and/or NRF2-2 shRNA, GCTCCTACTGTGATGTGAAAT (SEQ ID NO: 2).
14. The method of claim 1 , wherein the PI3 kinase inhibitor reduces NRF2-mediated transcription.
15. The method of claim 1 , further comprising characterizing radiation resistance of the cell by detecting a TP53 mutation in the cancer, wherein a TP53 missense mutation identifies the cancer as radiation resistant and a TP53 disruptive mutation identifies the cancer as radiation sensitive.
16. The method of claim 1 , further comprising characterizing radiation resistance of the cell by assaying a TP53 DNA binding domain (aa. 101-305) for mutations.
17. The method of claim 1 , further comprising characterizing radiation resistance of the cell by detecting a NFE2L2 mutation associated with radiation resistance.
18. A method of treating a subject with non-small cell lung cancer, the method comprising
(a) characterizing the radiation-susceptibility of the non-small cell lung cancer by detecting a TP53 or NFE2L2 mutation in the subject; and
(b) administering to the subject radiation and a PI3 kinase inhibitor, thereby enhancing the subject's sensitivity to radiation.