Methods for modulating chemotherapeutic cytotoxicity
Methods of reducing cytotoxicity of a chemotherapeutic agent to non-cancer cells by administering to a subject with cancer an effective amount of an agent that inhibits CD47 signaling and a DNA damaging agent, such as an anthracycline, topoisomerase inhibitor, or nucleotide synthesis inhibitor, are provided. Example disclosed methods reduce cardiotoxicity. In one example, the methods include administering to a subject with cancer an effective amount of a CD47 antisense morpholino oligonucleotide and an anthracycline such as doxorubicin. Methods of increasing cytotoxicity of a chemotherapeutic agent in cancer cells by administering to a subject with a tumor an effective amount of an agent that inhibits CD47 signaling and a DNA damaging agent such as an anthracycline, topoisomerase inhibitor, or nucleotide synthesis inhibitor, are also provided. In some embodiments, the inhibitor of CD47 signaling is administered to the subject before, during, or after the administration of the DNA damaging agent.
1. A method of reducing cytotoxicity of an anthracycline, a topoisomerase inhibitor, or a nucleotide synthesis inhibitor to non-cancer cells in a subject in need thereof, comprising administering to the subject an effective amount of:
an antisense CD47 morpholino oligonucleotide; and
the anthracycline, the topoisomerase inhibitor, or the nucleotide synthesis inhibitor,
wherein the antisense CD47 morpholino oligonucleotide is administered to the subject before, during, or after administration of the anthracycline, the topoisomerase inhibitor, or the nucleotide synthesis inhibitor.
2. The method of claim 1 , wherein the anthracycline is doxorubicin, daunorubicin, epirubicin, idarubicin, or valrubicin.
3. The method of claim 1 , wherein the nucleotide synthesis inhibitor is cladribine, clofarabine, fludarabine, mercaptopurine, thioguanine, pentostatin, capecitabine, cytarabine, 5-fluorouracil, floxuridine, or gemcitabine.
4. The method of claim 1 , wherein the topoisomerase inhibitor is camptothecin, topotecan, irinotecan, or etoposide.
5. The method of claim 1 , wherein the antisense CD47 morpholino oligonucleotide comprises the nucleic acid sequence CGTCACAGGCAGGACCCACTGCCCA (SEQ ID NO: 3).
6. The method of claim 1 , wherein the subject has breast cancer, lung cancer, ovarian cancer, prostate cancer, thyroid cancer, bladder cancer, stomach cancer, multiple myeloma, soft tissue sarcoma, leukemia, or lymphoma.
7. The method of claim 1 , wherein the cytotoxicity of the anthracycline, the topoisomerase inhibitor, or the nucleotide synthesis inhibitor to non-cancer cells is cardiotoxicity, nephrotoxicity, hepatotoxicity, myelosuppression, alopecia, gastrointestinal distress, or peripheral neuropathy.
8. The method of claim 1 , wherein the antisense CD47 morpholino oligonucleotide is administered to the subject prior to administration of the anthracycline, the topoisomerase inhibitor, or the nucleotide synthesis inhibitor.
9. The method of claim 8 , wherein the antisense CD47 morpholino oligonucleotide is administered to the subject at least about 24 hours prior to administration of the anthracycline, the topoisomerase inhibitor, or the nucleotide synthesis inhibitor or at least about 48 hours prior to the administration of the anthracycline, the topoisomerase inhibitor, or the nucleotide synthesis inhibitor.
10. The method of claim 1 , further comprising detecting cytotoxicity to non-cancer cells in the subject by detecting a reduction or inhibition of cardiotoxicity in the subject compared to a control.
11. The method of claim 1 , further comprising selecting a subject who is at risk for cytotoxicity of the anthracycline, the topoisomerase inhibitor, or the nucleotide synthesis inhibitor to non-cancer cells for administration of the antisense CD47 morpholino oligonucleotide and the anthracycline, the topoisomerase inhibitor, or the nucleotide synthesis inhibitor, wherein the subject has pre-existing heart disease, hypertension, previous mediastinal irradiation, female gender, and/or age less than 4 years, or the subject has received a cumulative dose of greater than 400 mg/m 2 and/or administration of an anthracycline at more than 50 mg/m 2 dose per day.
12. A method of reducing cytotoxicity of an anthracycline, a topoisomerase inhibitor, or a nucleotide synthesis inhibitor to non-cancer cells in a subject in need thereof, comprising:
(a) administering an antisense CD47 morpholino oligonucleotide to the subject;
(b) administering the anthracycline, the topoisomerase inhibitor, or the nucleotide synthesis inhibitor to the subject, wherein (a) and (b) can be performed in either order or concurrently; and
(c) detecting a reduction of cytotoxicity to non-cancer cells in the subject by detecting a reduction or inhibition of cardiotoxicity, nephrotoxicity, hepatotoxicity, myelosuppression, alopecia, gastrointestinal distress, or peripheral neuropathy in the subject compared to a control.
13. The method of claim 12 , further comprising selecting a subject who is at risk for cytotoxicity of the DNA damaging agent to non-cancer cells for administration of the antisense CD47 morpholino oligonucleotide and the anthracycline, the topoisomerase inhibitor, or the nucleotide synthesis inhibitor, wherein the subject has pre-existing heart disease, hypertension, previous mediastinal irradiation, female gender, and/or age less than 4 years, or the subject has received a cumulative dose of greater than 400 mg/m 2 and/or administration of an anthracycline at more than 50 mg/m 2 dose per day.