Methods and compositions for cDNA synthesis and single-cell transcriptome profiling using template switching reaction
This application discloses methods for cDN′A synthesis with improved reverse transcription, template switching and preamplification to increase both yield and average length of cDNA libraries generated from individual cells. The new methods include exchanging a single nucleoside residue for a locked nucleic acid (INA) at the TSO 3′ end, using a methyl group donor, and/or a MgCb concentration higher than conventionally used. Single-cell transcriptome analyses incorporating these differences have full-length coverage, improved sensitivity and accuracy, have less bias and are more amendable to cost-effective automation. The invention also provides cDNA molecules comprising a locked nucleic acid at the 3′-end, compositions and cDNA libraries comprising these cDNA molecules, and methods for single-cell transcriptome profiling.
1. A method for preparing DNA that is complementary to an RNA molecule, comprising the steps of:
annealing a cDNA synthesis primer to said RNA molecule and synthesizing a first cDNA strand to form an RNA-cDNA intermediate; and
conducting a reverse transcriptase reaction by contacting said RNA-cDNA intermediate with a template switching oligonucleotide (TSO), wherein the TSO comprises a locked nucleic acid (LNA) at its 3′-most end, under conditions suitable for extension of the first DNA strand that is complementary to the RNA molecule, rendering it additionally complementary to the TSO.
2. The method of claim 1 , wherein said reverse transcription reaction is conducted in the presence of a methyl group donor and a metal salt.
3. The method of claim 2 , wherein said methyl group is betaine.
4. The method of claim 2 , wherein said metal salt is magnesium salt.
5. The method of claim 4 , wherein said magnesium salt has a concentration of at least 7 mM.
6. The method of claim 1 , wherein said template switching oligonucleotide comprises at least one or two ribonucleotide residues and said LNA residue.
7. The method of claim 6 , wherein said at least one or two ribonucleotide residues are riboguanine.
8. The method of claim 6 , wherein said locked nucleic acid residue is selected from the group consisting of locked guanine, locked adenine, locked uracil, locked thymine, locked cytosine, and locked 5-methylcytosine.
9. The method of claim 8 , wherein said locked nucleic acid residue is locked guanine.
10. The method of claim 1 , wherein said template switching oligonucleotide comprises at a 3′-end three nucleotide residues characterized by formula rGrG+N, wherein +N represents a locked nucleotide residue.
11. The method of claim 10 , wherein said template switching oligonucleotide comprises rGrG+G.
12. The method of claim 2 , wherein said methyl group donor is betaine, and said metal salt is MgCl 2 at a concentration of at least 9 mM.
13. The method of claim 1 , further comprising amplifying said DNA strand that is complementary to said RNA molecule and said template switching oligonucleotide using an oligonucleotide primer.
14. The method of claim 1 , wherein said template switching oligonucleotide is selected from the group consisting of:
i.
rGrG+G (AAGCAGTGGTATCAACGCAGAGTACrGrG+G),
ii.
rGrG+N (AAGCAGTGGTATCAACGCAGAGTACrGrG+N),
iii.
+G+G+G (AAGCAGTGGTATCAACGCAGAGTAC+G+G+G),
and
iv.
rG+G+G (AAGCAGTGGTATCAACGCAGAGTACrG+G+G).
15. The method of claim 1 , wherein the cDNA is synthesized on beads comprising an anchored oligo-dT primer.
16. The method of claim 15 , wherein said oligo-dT primer comprises a sequence of 5′-AAGCAGTGGTATCAACGCAGAGTACT 30 VN-3′, wherein “N” is any nucleoside base, and “V” is selected from the group consisting of “A”, “C” and “G”.
17. The method of claim 13 , further comprising PCR preamplification, tagmentation, and final PCR amplification.
18. A method for analyzing gene expression in a plurality of single cells, the method comprising the steps of: preparing a cDNA library according to the method of claim 1 ; and sequencing the cDNA library.
19. A template switching oligonucleotide (TSO) comprising a locked nucleotide residue at its 3′-most end.
20. The TSO of claim 19 , comprising three nucleotide residues at a 3′-end selected from the group consisting of +N+N+N, N+N+N, NN+N, rN+N+N, and rNrN+N, wherein N at each occurrence is independently a deoxyribonucleotide residue, rN at each occurrence is independently a ribonucleotide residue, and +N at each occurrence is independently a locked nucleotide residue.
21. The TSO of claim 19 , wherein said locked nucleotide residue is selected from the group consisting of locked guanine, locked adenine, locked uracil, locked thymine, locked cytosine, and locked 5-methylcytosine.
22. The TSO of claim 20 , wherein said three nucleotide residues are selected from the group consisting of NN+G, rNrN+G, GG+N, rGrG+G, and GG+G.
23. The method of claim 1 , wherein said RNA is total RNA in a cell.
24. The method of claim 13 , wherein optionally the PCR preamplification is conducted without purifying the cDNA obtained from reverse transcription reaction.