Compositions of ascorbic acid and bone morphogenetic protein 4 (BMP-4) for cell growth and uses related thereo

1. A method of making cardio-mimetic tissue by mixing fibroblast cells with ascorbic acid and bone morphogenetic protein 4 and inserting into the fibroblast cells a nucleobase polymer with a nucleotide sequence consisting of or comprising a sequence selected from AUAAGACGAACAAAAGGUUUGU (SEQ ID NO: 1), or variant with 65% or greater identity thereto, and under conditions such that a tissue is formed that is capable of spontaneously contracting.

2. The method of claim 1 , wherein the cells are human dermal fibroblasts.

3. The method of claim 1 , wherein inserting the nucleobase polymer is done by mixing the nucleobase polymer in the presence a cationic lipid and exposing the mixture to a fibroblast cell or by incorporating the nucleotide sequence in a viral nucleic acid or particle, plasmid, or other vector.

4. The method of claim 1 , wherein the cardio-mimetic tissue comprises cells that have an increased expression of mRNA Myh6 when compared to cells mixed with ascorbic acid and bone morphogenetic protein 4 in the absence of the nucleobase polymer.

5. The method of claim 1 , wherein the cardio-mimetic tissue comprises cells have increased expression of TNNT2 when compared to cells mixed with ascorbic acid and bone morphogenetic protein 4 in the absence of the nucleobase polymer.

6. The method of claim 1 , wherein the variant of SEQ ID NO: 1 has one, two, three, four, five, six, or seven nucleotide substitutions, deletions, or combinations thereof.

7. The method of claim 1 , wherein the variant of SEQ ID NO: 1 comprises the sequence UAAGACXXXCA(X) n AXGCUU (SEQ ID NO: 2) wherein n is 2 or 3, U is individually and independently uracil or thymine, and X is individually at each occurrence any nucleotide.

8. A method of treating heart disease comprising,

isolating fibroblast cells from a subject diagnosed with heart disease thereby providing isolated fibroblast cells;

making cardio-mimetic tissue capable of spontaneously contracting by the process of inserting or expressing inside the isolated fibroblast cells a nucleobase polymer comprising a nucleotide sequence consisting of or comprising AUAAGACGAACAAAAGGUUUGU (SEQ ID NO: 1), or variant with 65% or greater identity thereto, and then contacting the isolated fibroblast cells with ascorbic acid and bone morphogenetic protein 4 under conditions such that a tissue capable of spontaneously contracting is formed thereby providing a cardiomimetic tissue; and

implanting the cardio-mimetic tissue effectively on or in the heart of the subject.

9. The method of claim 8 , wherein the cells are fibroblasts or human dermal fibroblasts.

10. The method of claim 8 , wherein inserting the nucleobase polymer is done by mixing the nucleobase polymer in the presence a cationic lipid and exposing the mixture to a fibroblast cell or by incorporating the nucleotide sequence in a viral nucleic acid or particle, plasmid, or other vector.

11. A method of treating heart disease comprising administering an effective amount of ascorbic acid or prodrug thereof and bone morphogenetic protein 4 in combination with an expression vector encoding a nucleobase polymer comprising sequence AUAAGACGAACAAAAGGUUUGU SEQ ID NO: 1 or variant with 65% or greater identity thereto, to a subject in need thereof, wherein administration is by injection into a peritoneal cavity or heart of the subject.

12. The method of claim 11 , wherein the subject is a human.

13. The method of claim 11 , wherein bone morphogenetic protein 4 is a human isoform.

14. The method of claim 11 , wherein the subject is diagnosed with a myocardial infarction.