Means and Methods for the Treatment of Nephropathy

1 . An antagonist of CCL2 for use in a method for the treatment and/or prevention of a disease, wherein the method comprises administering the antagonist to a subject, wherein the subject is suffering from proteinuria.

2 . The antagonist of claim 1 , wherein the disease is a renal disease.

3 . The antagonist of claim 1 , wherein the disease is nephropathy.

4 . The antagonist of claim 1 , wherein the disease is diabetic nephropathy.

5 . The antagonist of claim 1 , wherein the disease is a diabetes.

6 . The antagonist of claim 1 , wherein the disease is a cardiovascular disease primary and secondary amyloidosis, focal-segmental glomerulosclerosis, lupus nephritis, Fabry disease, glomerulonephritis, membranous glomerulopathy, hepatorenal syndrome, IgA nephropathy, cryoglobulinemia, multiple myeloma, Nagel-Patella syndrome, hereditary nephritis, polyarteriitis nodosa, purpura Schoenlein-Henoch, ANCA-associated vasculitides, nephrotic syndrome and rapid progressive glomerulonephritides.

7 . The antagonist of claim 1 , wherein the disease is hypertension.

8 . (canceled)

9 . The antagonist of claim 1 , wherein proteinuria comprises a urinary albumin/creatine ratio (ACR) of at least 30 mg/g.

10 .- 11 . (canceled)

12 . The antagonist of claim 1 , wherein proteinuria comprises a glomerular filtration rate of at least 90 ml/min/1.73 m 2 .

13 .- 29 . (canceled)

30 . The antagonist of claim 1 , wherein the HbA1c value of the subject is above 7.95%.

31 .- 32 . (canceled)

33 . The antagonist of claim 1 , wherein the subject has at least one of the following characteristics:

(i) the subject is diagnosed type 2 diabetes mellitus according to the American Diabetes Association (ADA) definition;

(ii) the subject is on stable treatment to control hypertension, hyperglycemia and/or dyslipidemia; or

(iii) the subject is on stable treatment with angiotensin-converting enzyme inhibitors (ACEi) and/or Angiotensin II receptor blockers (ARBs).

34 .- 35 . (canceled)

36 . The antagonist of claim 1 , wherein the subject has at least one of following characteristics.

(i) the subject is not suffering from type 1 diabetes mellitus;

(ii) the eGFR of the subject is not ≦25 ml/min/1.73 m 2 ; and

(iii) the subject did not have any cardiovascular event within 3 months prior to the onset of the administration of the antagonist;

(iv) the subject is not suffering from uncontrolled hypertension, preferably the upper limit of the blood pressure of the subject is 180/110 mm Hg;

(v) the subject was not subject to dialysis within 3 months prior to the onset of the administration of the antagonist;

(vi) the subject did not experience any acute kidney injury within 3 months prior to the onset of the administration of the antagonist;

(vii) the subject does not have or undergo any significant edema, leg ulcer and infectious disease;

(viii) the subject does not use a drug selected from the group consisting of a thiazolidinedione class drug and an immune suppressant;

(ix) the subject does not undergo steroid therapy except a steroid therapy for topical use or inhalation; or

(x) the subject does not chronically use of non-steroidal anti-inflammatory drug (NSAIDs), cyclooxygenase type 2 (COX-2) inhibitors, two or more diuretic drugs and/or aliskiren.

37 . (canceled)

38 . The antagonist of claim 1 , wherein the antagonist is an antagonist of the CCL2.CCR2 axis.

39 . The antagonist of claim 1 , wherein the antagonist is a Spiegelmer, an aptamer or both.

40 .- 46 . (canceled)

47 . The antagonist of claim 1 , wherein the antagonist is a nucleic acid molecule comprising a type 2 MCP-1 binding nucleic acid molecule, a type 3 MCP-1 binding nucleic acid molecule, a type 4 MCP-1 binding nucleic acid molecule, a type 1A MCP-1 binding nucleic acid molecule, a type 1B MCP-1 binding nucleic acid molecule or a type 5 MCP-1 binding nucleic acid molecule,

(a) whereby the type 2 MCP-1 binding nucleic acid molecule comprises in 5′->3′ direction a first terminal stretch of nucleotides, a central stretch of nucleotides, and a second terminal stretch of nucleotides, whereby

(i) the first terminal stretch of nucleotides comprises a nucleotide sequence selected from the group comprising ACGCA, CGCA and GCA,

(ii) the central stretch of nucleotides comprises a nucleotide sequence of CSUCCCUCACCGGUGCAAGUGAAGCCGYGGCUC, and

(iii) the second terminal stretch of nucleotides comprises a nucleotide sequence selected from the group comprising UGCGU, UGCG and UGC,

(b) whereby the type 3 MCP-1 binding nucleic acid molecule comprises in 5′->3′ direction a first terminal stretch of nucleotides, a first central stretch of nucleotides, a second central stretch of nucleotides, a third central stretch of nucleotides, a fourth central stretch of nucleotides, a fifth central stretch of nucleotides, a sixth central stretch of nucleotides, a seventh central stretch of nucleotides and a second terminal stretch of nucleotides, whereby

(i) the first terminal stretch of nucleotides comprises a nucleotide sequence which is selected from the group comprising GURCUGC, GKSYGC, KBBSC and BNGC,

(ii) the first central stretch of nucleotides comprises a nucleotide sequence of GKMGU,

(iii) the second central stretch of nucleotides comprises a nucleotide sequence of KRRAR,

(iv) the third central stretch of nucleotides comprises a nucleotide sequence of ACKMC,

(v) the fourth central stretch of nucleotides comprises a nucleotide sequence selected from the group comprising CURYGA, CUWAUGA, CWRMGACW and UGCCAGUG,

(vi) the fifth central stretch of nucleotides comprises a nucleotide sequence selected from the group comprising GGY and CWGC,

(vii) the sixth central stretch of nucleotides comprises a nucleotide sequence selected from the group comprising YAGA, CKAAU and CCUUUAU,

(viii) the seventh central stretch of nucleotides comprises a nucleotide sequence selected from the group comprising GCYR and GCWG, and

(ix) the second terminal stretch of nucleotides comprises a nucleotide sequence selected from the group comprising GCAGCAC, GCRSMC, GSVVM and GCNV,

(c) whereby the type 4 MCP-1 binding nucleic acid molecule comprises in 5′->3′ direction a first terminal stretch of nucleotides, a central stretch of nucleotides and a second terminal stretch of nucleotides, whereby

(i) the first terminal stretch of nucleotides comprises a nucleotide sequence selected from the group comprising AGCGUGDU, GCGCGAG, CSKSUU, GUGUU, and UGUU;

(ii) the central stretch of nucleotides comprises a nucleotide sequence selected from the group comprising AGNDRDGBKGGURGYARGUAAAG, AGGUGGGUGGUAGUAAGUAAAG and CAGGUGGGUGGUAGAAUGUAAAGA, and

(iii) the second terminal stretch of nucleotides comprises a nucleotide sequence selected from the group comprising GNCASGCU, CUCGCGUC, GRSMSG, GRCAC, and GGCA,

(d) whereby the type 1A MCP-1 binding nucleic acid molecule comprises in 5′->3′ direction a first terminal stretch of nucleotides, a first central stretch of nucleotides, a second central stretch of nucleotides, a third central stretch of nucleotides, a fourth central stretch of nucleotides, a fifth central stretch of nucleotides and a second terminal stretch of nucleotides, whereby

(i) the first terminal stretch of nucleotides comprises a nucleotide sequence of AGCRUG,

(ii) the first central stretch of nucleotides comprises a nucleotide sequence of CCCGGW,

(iii) the second central stretch of nucleotides comprises a nucleotide sequence of GUR,

(iv) the third central stretch of nucleotides comprises a nucleotide sequence of RYA,

(v) the fourth central stretch of nucleotides comprises a nucleotide sequence of GGGGGRCGCGAYC

(vi) the fifth central stretch of nucleotides comprises a nucleotide sequence of UGCAAUAAUG or URYAWUUG, and

(vii) the second terminal stretch of nucleotides comprises a nucleotide sequence of CRYGCU,

(e) whereby the type 1B MCP-1 binding nucleic acid molecule comprises in 5′->3′ direction a first terminal stretch of nucleotides, a first central stretch of nucleotides, a second central stretch of nucleotides, a third central stretch of nucleotides, a fourth central stretch of nucleotides, a fifth central stretch of nucleotides and a second terminal stretch of nucleotides, whereby

(i) the a first terminal stretch of nucleotides comprises a nucleotide sequence of AGYRUG,

(ii) the first central stretch of nucleotides comprises a nucleotide sequence of CCAGCU or CCAGY,

(iii) the second central stretch of nucleotides comprises a nucleotide sequence of GUG,

(iv) the third central stretch of nucleotides, comprises a nucleotide sequence of AUG,

(v) the fourth central stretch of nucleotides comprises a nucleotide sequence of GGGGGGCGCGACC,

(vi) the fifth central stretch of nucleotides comprises a nucleotide sequence of CAUUUUA or CAUUUA, and

(vii) the second terminal stretch of nucleotides comprises a nucleotide sequence of CAYRCU, and

(f) whereby the type 5 MCP-1 binding nucleic acid molecule comprises a nucleotide sequence according to any one of SEQ ID NOs:87 to 115.

48 .- 53 . (canceled)

54 . The antagonist of claim 1 , wherein the antagonist comprises a nucleic acid.

55 . The antagonist of claim 1 , wherein the antagonist is a protein.

56 .- 62 . (canceled)

63 . A method for the treatment of a disease, wherein the method comprises administering to a subject an antagonist of claim 1 , wherein the subject is suffering from proteinuria.

64 .- 65 . (canceled)

66 . A method for in situ improvement of glomerular filtration of kidney in a subject, wherein the method comprises administering to the subject an antagonist as defined in claim 1 , wherein the subject is suffering from proteinuria.

67 . (canceled)

68 . A method for in situ repair of kidney in a subject, wherein the method comprises administering to the subject an antagonist as defined in claim 1 , wherein the subject is suffering from proteinuria.

69 .- 76 . (canceled)