RNA interference in dermal and fibrotic indications

1. A method for treating or preventing a fibrotic disorder, the method comprising administering to a subject in need thereof a therapeutically effective amount of a double-stranded ribonucleic acid (dsRNA) directed against CTGF comprising a sense strand and an antisense strand, wherein the sense strand comprises at least 12 contiguous nucleotides of a sequence selected from the group consisting of

SEQ ID NOs: 2463 (GCACCUUUCUAGA), 3429 (G.mC.A.mC.

mC.mU.mU.mU.mC.mU.A*mG*mA.TEG-Chl), 2443 (UUGCACC

UUUCUAA), 3445 (mU.mU.G.mC.A.mC.mC.mU.mU.mU.mC.mU*

mA*mA.TEG-Chl), 2465 (CCUUUCUAGUUGA),

and

3469 (mC.mC.mU.mU.mU.mC.mU.A.G.mU.mU*mG*mA.TEG-Chi)

and/or wherein the antisense strand comprises at least 12 contiguous nucleotides of a sequence selected from the group consisting of

SEQ ID NOs: 2464 (UCUAGAAAGGUGCAAACAU), 3430 (P.

mU.fC.fU.A.G.mA.A.mA.G.G.fU.G.mC*A*A*A*mC*A*U), 4203

(UUAGAAAGGUGCAAACAAGG), 3446 (P.mU.fU.A.G.A.mA.A.

G.G.fU.G.fC.mA.mA*mA*fC*mA*mA*mG* G.), 2466

(UCAACUAGAAAGGUGCAAA),

and

3470 (P.mU.fC.A.A.fC.fU.A.G.A.mA.A.G.G*

fU*mG*fC*mA*mA*A.),

wherein the antisense strand is 16-23 nucleotides long and the sense strand is 8-15 nucleotides long, wherein the sd-rxRNA includes a double-stranded region and a single-stranded region, wherein the double-stranded region is from 8-15 nucleotides long, wherein the single-stranded region is at the 3′ end of the antisense strand and is 4-12 nucleotides long, wherein the single-stranded region contains 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 phosphorothioate modifications, and wherein at least 40% of the nucleotides of the isolated double-stranded nucleic acid molecule are modified.

2. The method of claim 1 , wherein the dsRNA is administered via intradermal injection.

3. The method of claim 1 , wherein the dsRNA is administered locally to the skin.

4. The method of claim 1 , wherein two or more dsRNAs are administered simultaneously or sequentially.

5. The method of claim 1 , wherein the dsRNA is hydrophobically modified.

6. The method of claim 1 , wherein the dsRNA is linked to a hydrophobic conjugate.

7. The method of claim 1 , wherein the sense strand comprises

SEQ ID NO: 2463

(GCACCUUUCUAGA)

and the antisense strand comprises

SEQ ID NO: 2464

(UCUAGAAAGGUGCAAACAU).

8. The method of claim 7 , wherein the sense strand comprises

SEQ ID NO: 3429

(G.mC. A.mC.mC.mU.mU.mU.mC.mU. A*mG*mA.TEG-Chl)

and the antisense strand comprises

SEQ ID NO: 3430

(P.mU.fC.fU. A. G.mA. A.mA. G. G.fU. G.mC* A* A*

A*mC* A* U).

9. The method of claim 1 , wherein the sense strand comprises

SEQ ID NO: 2443

(UUGCACCUUUCUAA)

and the antisense strand comprises

SEQ ID NO: 4203

(UUAGAAAGGUGCAAACAAGG).

10. The method of claim 9 , wherein the sense strand comprises

SEQ ID NO: 3445

(mU.mU.G.mC.A.mC.mC.mU.mU.mU.mC.mU*mA* mA.TEG-Chl)

and the antisense strand comprises

SEQ ID NO: 3446

(P.mU.fU. A. G. A.mA. A. G. G.fU.

G.fC.mA.mA*mA*fC*mA*mA*mG* G.).

11. The method of claim 1 , wherein the sense strand comprises

SEQ ID NO: 2465

(CCUUUCUAGUUGA)

and the antisense strand comprises

SEQ ID NO: 2466

(UCAACUAGAAAGGUGCAAA).

12. The method of claim 11 , wherein the sense strand comprises

SEQ ID NO: 3469

(mC.mC.mU.mU.mU.mC.mU. A. G.mU.mU*mG*mA.TEG-Chl)

and the antisense strand comprises

SEQ ID NO: 3470

(P.mU.fC. A. A.fC.fU. A. G. A.mA. A. G.

G*fU*mG*fC*mA*mA* A.).

13. The method of claim 1 , wherein the fibrotic disorder is selected from the group consisting of pulmonary fibrosis, liver cirrhosis, scleroderma and glomerulonephritis, lung fibrosis, liver fibrosis, skin fibrosis, muscle fibrosis, radiation fibrosis, kidney fibrosis, proliferative vitreoretinopathy, restenosis and uterine fibrosis, and trabeculectomy failure due to scarring.

14. The method of claim 1 wherein the dsRNA is formulated for delivery to the skin, for topical delivery, for intradermal injection and/or wherein the dsRNA is in a neutral formulation.

15. A method for treating or preventing a fibrotic disorder, the method comprising administering to a subject in need thereof a therapeutically effective amount of a double-stranded ribonucleic acid (dsRNA) directed against CTGF comprising a sense strand and an antisense strand, wherein the sense strand comprises at least 12 contiguous nucleotides of a sequence selected from the group consisting of

SEQ ID NOs: 2459

(GUGACCAAAAGUA)

or

3493

(G.mU. G. A.mC.mC. A. A. A. A. G*mU*mA.TEG-Chl)

and/or wherein the antisense strand comprises at least 12 contiguous nucleotides of

SEQ ID NOs: 2460

(UACUUUUGGUCACACUCUC)

or

3494

P.mU. A.fC.fU.fU.fU.fU. G. G.fU.mC.

A.mC*A*mC*mU*mC*mU* C.),

wherein the dsRNA is an sd-rxRNA,

wherein the antisense strand is 16-23 nucleotides long and the sense strand is 8-15 nucleotides long, wherein the sd-rxRNA includes a double-stranded region and a single-stranded region, wherein the double-stranded region is from 8-15 nucleotides long, wherein the single-stranded region is at the 3′ end of the antisense strand and is 4-12 nucleotides long, wherein the single-stranded region contains 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 phosphorothioate modifications, and wherein at least 40% of the nucleotides of the isolated double-stranded nucleic acid molecule are modified.

16. The method of claim 15 , wherein the sense strand comprises

SEQ ID NO: 2459

(GUGACCAAAAGUA)

and the antisense strand comprises

SEQ ID NO: 2460

(UACUUUUGGUCACACUCUC),

or the sense strand comprises

SEQ ID NO: 3493

(G.mU. G.A.mC.mC. A. A. A. A. G*mU*mA.TEG-Chl)

and the antisense strand comprises

SEQ ID NO: 3494

(P.mU. A.fC.fU.fU.fU.fU. G. G.fU.mC. A.mC* 

A*mC*mU*mC*mU* C.).

17. The method of claim 14 , wherein the dsRNA is administered via intradermal injection.

18. The method of claim 14 , wherein the dsRNA is administered locally to the skin.

19. The method of claim 14 , wherein dsRNA is hydrophobically modified.

20. The method of claim 14 , wherein the dsRNA is linked to a hydrophobic conjugate.