RAAV-based compositions and methods for treating amyotrophic lateral sclerosis
The invention relates to inhibitory nucleic acids and rAAV-based compositions, methods and kits useful for treating Amyotrophic Lateral Sclerosis.
1. A method of inhibiting SOD1 expression in a cell, the method comprising:
delivering to the cell an miRNA that targets SOD1 mRNA, wherein the miRNA comprises
20 or 21 continuous nucleotides encoded by a sequence set forth in: SEQ ID NO: 17: CTGCATGGATTCCATGTTCAT (SOD-miR-127).
2. A method of treating a subject having or suspected of having ALS, the method comprising:
administering to the subject an effective amount of a recombinant adeno-associated virus (rAAV) harboring a nucleic acid that is engineered to express, in a cell of the subject, an miRNA that targets RNA encoded by a SOD1 gene, wherein the miRNA comprises
20 or 21 continuous nucleotides encoded by a sequence set forth in: SEQ ID NO: 17: CTGCATGGATTCCATGTTCAT (SOD-miR-127).
3. The method of claim 2 , wherein the rAAV targets CNS tissue, or wherein the rAAV comprises an AAV.Rh10 or AAV9 capsid protein.