MicroRNAs 206 and 21 cooperate to promote RAS-extracellular signal-regulated kinase signaling by suppressing the translation of RASA1 and SPRED1
The present invention provides a method for inhibiting the RAS-ERK pathway by upregulation of RASA1 and SPRED1 mRNAs in tumor cells by anti-miR treatment. The method includes wherein an anti-miR-206 binds to a nucleotide comprising the sequence UAGCUUAUCAGACU (SEQ ID NO: 21), or to a nucleotide comprising the sequence UGGAAUGUAAGGAAGUGUGUGG (SEQ ID NO: 9). A method of re-expression of RAS-ERK pathway inhibitory proteins in triple negative cancer cells by administering to a patient having cancer an effective amount of an antagonist of KLF4-dependent microRNAs.
1. A method of treating a patient having triple negative breast cancer by administering to said patient a therapeutically effective amount of an anti-microRNA 206 and a therapeutically effective amount of an anti-microRNA 21.