Serial quantitative PCR assay for detection, species-discrimination and quantification of
The invention provides a method for determining the presence, species, and/or quantity of Leishmania in a sample.
1. A method for determining the presence and species of a Leishmania in a sample, and distinguishing the Leishmania species so determined from other Leishmania species of interest present in the sample, the method comprising:
(a) contacting the sample with the forward-and-reverse primer pairs GGGTAGGGGCGTTCTGC (SEQ ID NO:1) and TACACCAACCCCCAGTTTGC (SEQ ID NO: 2) (kDNA 1 minicircle forward and reverse primers, respectively); TGCTATAAAATCGTACCACCCGACA (SEQ ID NO: 101) and GAACGGGGTTTCTGTATGCCATTT (SEQ ID NO: 102) ( L . (Y) braziliensis kDNA 3 forward and reverse primers, respectively); AGAGCGTGCCTTGGATTGTG (SEQ ID NO: 49) and CGCTGCGTTGATTGCGTTG (SEQ ID NO: 50) (MSP Associated Gene I (MAG I) forward and reverse primers, respectively); and GGAGAAACTCACGGCACAGG (SEQ ID NO: 67) and GCGCCTCGTAGGTCACAGTT (SEQ ID NO: 68) (SLACS forward and reverse primers, respectively); thereby forming Leishmania -primer pair complexes;
(b) exposing the Leishmania -primer pair complexes of (a) to a thermo-stable polymerase and deoxyribonucleoside triphosphates to produce (1) double-stranded DNAs containing the primer sequences and (2) pyrophosphates;
(c) performing temperature cycles to permit further production of additional double-stranded DNAs containing the primer sequences and additional pyrophosphates;
(d) determining the melting temperature of the double-stranded DNA product of (c), a characteristic melting temperature being indicative of particular Leishmania species so detected by the forward-and-reverse primer pairs of (a); and
(e) comparing the melting temperature of (d) to a characteristic melting temperature for particular Leishmania species so detected by the forward-and-reverse primer pairs of (a);
thereby determining the presence and the species of the Leishmania in the sample, wherein the Leishmania species of interest comprises any of Leishmania tropica, Leishmania chagasi/Leishmania infantum, Leishmania donovani, Leishmania major, Leishmania braziliensis, Leishmania guyanensis/Leishmania panamensis, Leishmania mexicana , and Leishmania amazonensis.
2. The method of claim 1 , wherein the Leishmania species of interest are species found in a geographic region of North, Central and South America.
3. The method of claim 1 , wherein the Leishmania species of interest are species found in a geographic region of Europe.
4. The method of claim 3 , wherein the Leishmania species of interest found in a geographic region of Europe are one or more of L . (L.) infantum and L . (L.) donovani.
5. The method of claim 1 , wherein the Leishmania species of interest are species found in a geographic region of the Middle East, Northern and sub-Saharan Africa.
6. The method of claim 5 , wherein the species found in a geographic region of Middle East, Northern and sub-Saharan Africa are one or more of L . (L.) major, L . (L.) tropica , and L . (L.) infantum and L . (L.) donovani.
7. The method of claim 5 , wherein the species found in a geographic region of Middle East, Northern and sub-Saharan Africa are one or more of L . (L.) infantum, L . (L.) donovani and L . (L.) tropica.
8. The method of claim 1 , wherein the Leishmania species of interest are species found in a geographic region of Asia.
9. The method of claim 8 , wherein the geographic region of Asia is India, Bangladesh, Pakistan, or Nepal.
10. The method of claim 8 , wherein the species found in Asia is L . (L.) donovani.
11. The method of claim 1 , wherein steps (a) through (f) are repeated using at least one nucleic acid primer pair that is different for each Leishmania species in the group.
12. The method of claim 1 , wherein the quantity of Leishmania in the sample is measured relative to a reference standard curve.
13. The method of claim 1 , wherein determining the melting temperature comprises using ultraviolet absorption detection, fluorescence detection, light scattering detection, colorimetric detection, or chromogenic detection.
14. The method of claim 1 , further comprising repeating the steps in (a) to (e), wherein step (a) comprises contacting the sample with one or more of the forward- and reverse primer pairs selected from:
AACTTTTCTGGTCCTCCGGGTAG (SEQ ID NO: 97) and ACCCCCAGTTTCCCGCC (SEQ ID NO: 98) (kDNA 2 forward and reverse primers, respectively); GGGTAGGGGCGTTCTGC (SEQ ID NO:3) and CCCGGCCTATTTTACACCAACC (SEQ ID NO:4) (kDNA 3 minicircle forward and reverse primers, respectively); GGGTGCAGAAATCCCGTTCA (SEQ ID NO:5) and CCCGGCCCTATTTTACACCA (SEQ ID NO: 6) (kDNA 4 minicircle forward and reverse primers, respectively); CTTTTCTGGTCCTCCGGGTAGG (SEQ ID NO: 99) and CCACCCGGCCCTATTTTACACCAA (SEQ ID NO: 100) (kDNA 5 minicircle forward and reverse primers, respectively); AATGGGTGCAGAAATCCCGTTC (SEQ ID NO: 7) and CCACCACCCGGCCCTATTTTAC (SEQ ID NO: 8) (kDNA 7 minicircle forward and reverse primers, respectively); GGTCCCGGCCCAAACTTTTC (SEQ ID NO: 9) and CCGGGGTTTCGCACTCATTT (SEQ ID NO: 10 ( L . (L.) amazonensis kDNA 1 forward and reverse primers, respectively); GGTAGGGGCGTTCTGCGAAT (SEQ ID NO: 11) and CCCGGCCTATTTTACACCAACC (SEQ ID NO: 12) ( L . (L.) amazonensis kDNA 2 forward and reverse primers, respectively); GGGTAGGGGCGTTCTGC (SEQ ID NO: 13) and TACACCAACCCCCAGTTTGC (SEQ ID NO: 14) ( L . (L.) amazonensis kDNA 3 forward and reverse primers, respectively); TGAGTGCAGAAACCCCGTTCATA (SEQ ID NO: 15) and ACACCAACCCCCAGTTGTGA (SEQ ID NO: 16) ( L . (L.) amazonensis kDNA 4 forward and reverse primers, respectively); AATTTCGCAGAACGCCCCTAC (SEQ ID NO: 17) and GTACTCCCCGACATGCCTCTG (SEQ ID NO:18) ( L . (V.) braziliensis kDNA 1 forward and reverse primers, respectively); TCCGCAGGAGACTTCGTATG (SEQ ID NO:103) and CACGACTATCCACCCCATCC (SEQ ID NO:104) ( L . (L.) infantum Minicircle 1 forward and reverse primers, respectively); ACGGGGTTTCTGCACCCATT (SEQ ID NO: 19) and GTAGGGGCGTTCTGCGAAAA (SEQ ID NO: 20) ( L . (L.) major Minicircle 1 forward and reverse primers, respectively); AATGCGAGTGTTGCCCTTTTG (SEQ ID NO: 21) and GCCGAACAACGCCATATTAACC (SEQ ID NO:22) ( L . (L.) mexicana Minicircle 1 forward and reverse primers, respectively); GGGGGTTGGTGTAAAATAGGG (SEQ ID NO:23) and ACCACCAGCAGAAGGTCAAAG (SEQ ID NO:24) ( L . (L.) tropica Minicircle 1 forward and reverse primers, respectively); GCGGTGGCTGGTTTTAGATG (SEQ ID NO:25) and TCCAATGAAGCCAAGCCAGT (SEQ ID NO:26) ( L . (L.) donovani Minicircle 1 forward and reverse primers, respectively); ATTTTAGTATGAGTGGTAGGTTTTGTT (SEQ ID NO: 27) and CAATAACTGGGACGGTTGCT (SEQ ID NO:28) (Cytochrome B1 forward and reverse primers, respectively); GCGGAGAGGAAAGAAAAGGCTTA (SEQ ID NO:29) and AAAAGTCATGCTAAACACACACCACA (SEQ ID NO: 30) ( L . (L.) amazonensis Cytochrome B1 forward and reverse primers, respectively); CAGGTTGCTTACTACGTGTTTATGGTG (SEQ ID NO: 31) and TCGTATTACAAACCCTAAATCAAAATCTCA (SEQ ID NO:32) ( L . (L.) tropica Cytochrome B1 forward and reverse primers, respectively); TCAGGTTGCTTACTACGTGTTTATGGTG (SEQ ID NO: 33) and TGCTAAACAAACACCACATATGATCTGC (SEQ ID NO: 34) ( L . (L.) tropica Cytochrome B2 forward and reverse primers, respectively); TGACACACATATTTTAGTGTGGGTGGTAGG (SEQ ID NO: 35) and TCCCCAATAAGACATCATTGTACATGGTAA (SEQ ID NO: 36) ( L . (L.) tropica Cytochrome B3 forward and reverse primers, respectively); CACATATTTTAGTGTGGGTGGTAGGTTTTG (SEQ ID NO: 37) and TCCCCAATAAGACATCATTGTACATGGTAA (SEQ ID NO: 38) ( L . (L.) tropica Cytochrome B4 forward and reverse primers, respectively); GCTTGGTTGGATTATTTTTGCTG (SEQ ID NO: 39) and AACAACATTTTAACTCTTGTAGGATTCG (SEQ ID NO: 40) (Maxicircle 1 forward and reverse primers, respectively); GAGGTGTTTGCCCGCATC (SEQ ID NO:41) and CTCGCCCATGTCGTCG (SEQ ID NO: 42) (Alpha-tubulin I forward and reverse primers, respectively); TGTCGCTTGCAGACCAGATG (SEQ ID NO:105) and GCATCGCAGGTGTGAGCA (SEQ ID NO: 106) (DNA polymerase I forward and reverse primers, respectively); AGGAGGATGGCAAGCGGAAG (SEQ ID NO: 43) and GCGACGGGTACAGGGAGTTG (SEQ ID NO:44) (DNA polymerase 2 forward and reverse primers, respectively); CGAAACTTCCGGAACCTGTCTT (SEQ ID NO: 45) and CACCACACGCACGCACAC (SEQ ID NO: 46) (Mini-exon forward and reverse primers, respectively); GTGTGGTGGCGGGTGTATGT (SEQ ID NO: 47) and GCCCAGGTCGCTGTGAGG (SEQ ID NO: 48) (Mini-exon 2 forward and reverse primers, respectively); AGTTTTGGTTGGCGCTCCTG (SEQ ID NO: 51) and CCCACTCGCTTTCCTTGGTC (SEQ ID NO:52) (MSP Associated Gene 2 (MAG 2) forward and reverse primers, respectively); CGACCCTGTCACCACCACAG (SEQ ID NO:53) and GAGGCCACCCTATCGCTGAC (SEQ ID NO:54) (SIDER repeat I forward and reverse primers, respectively); TCGTTGAGGGAGGAGGTGTTTC (SEQ ID NO:55) and TCGGCTTTGAGGTTGGCTTC (SEQ ID NO:56) ( L . (V) braziliensis DNA polymerase forward and reverse primers, respectively); ACGTCGCCAACTGCTTCACC (SEQ ID NO: 57) and GTGTTCGCACCGCCTTGAC (SEQ ID NO: 58) ( L . (V) braziliensis DNA polymerase 2 forward and reverse primers, respectively); GTCGTTGTCCGTGTCGCTGT (SEQ ID NO: 59) and CGCTGTGTGTGTCCGTGTGT (SEQ ID NO:60) ( L . (L.) major MSP associated gene I ( L. major MAG 1) forward and reverse primers, respectively); GACGACGACGAGGAGGATGG (SEQ ID NO: 61) and GCGACGGGTACAGGGAGTTG (SEQ ID NO: 62) ( L . (L.) amazonensis DNA polymerase I forward and reverse primers, respectively); CCAGATGCCGACCAAAGC (SEQ ID NO: 107) and CGCGCACGTGATGGATAAC (SEQ ID NO: 108) (GPI forward and reverse primers, respectively); GAAGGTGCAGTCCCTCGTGT (SEQ ID NO: 63) and CCTCCGTCTGCTTGCTCTTG (SEQ ID NO: 64) (HSP70-1 forward and reverse primers, respectively); or TCGAGATCGACGCGTTGTT (SEQ ID NO: 65) and CCGCACAGCTCCTCGAA (SEQ ID NO: 66) (HSP70-4 forward and reverse primers, respectively).
15. A method for determining whether a subject is suffering from a Leishmania infection by detecting the presence of Leishmania in a sample from the subject by the method of claim 1 .