Combination therapies targeting tumor-associated stroma or tumor cells and topoisomerase
The present invention provides, inter alia, methods for treating or ameliorating the effects of a disease, such as cancer, in a subject. The methods include: administering to a subject in need thereof (a) a therapeutically effective amount of a topoisomerase inhibitor; and (b) a therapeutically effective amount of a monoclonal antibody or antigen binding fragment thereof, wherein the monoclonal antibody contains: (i) a heavy chain variable region (VH), which includes an amino acid sequence selected from SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, and SEQ ID NO:7; and (ii) a light chain variable region (VL), which includes an amino acid sequence selected from SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, and SEQ ID NO:8. Compositions, including pharmaceutical compositions, and kits for treating diseases, such as cancer, are also provided herein.
1. A composition for treating a tumor in a human subject comprising:
(a) a topoisomerase inhibitor; and
(b) a monoclonal antibody or antigen binding fragment thereof, wherein the monoclonal antibody comprises:
(i) a heavy chain variable region (VH), which comprises an amino acid sequence of SEQ ID NO:5; and
(ii) a light chain variable region (VL), which comprises an amino acid sequence of SEQ ID NO:6 wherein the monoclonal antibody or antigen binding fragment thereof comprises a constant (Fc) region and binds to human tumor endothelial marker 8 (TEM8);
wherein the tumor comprises one or more of human TEM8 expressing tumor cells and human TEM8 expressing tumor stromal cells; and wherein the topoisomerase inhibitor is selected from the group consisting of: Adva-27a, zoptarelin doxorubicin, valrubicin, razoxane, doxorubicin, amsacrine, etoposide phosphate, etoposide, dexrazoxane, cytarabine/daunorubicin combination, CAP7.1, aldoxorubicin, amrubicin hydrochloride, vosaroxin, daunorubicin, milatuzumab/doxorubicin combination, aclarubicin, mitoxantrone, pirarubicin, epirubicin, teniposide, F-14512, elliptinium acetate, zorubicin, dexrazoxane, sobuzoxane, idarubicin, HU-331, aurintricarboxylic acid, pharmaceutically acceptable salts thereof, and combinations thereof.
2. The composition according to claim 1 , wherein the tumor cells express human TEM8.
3. The composition according to claim 1 , wherein the tumor cells and tumor stromal cells express human TEM8.
4. The composition according to claim 1 , wherein the tumor stromal cells express human TEM8.
5. The composition according to claim 4 , wherein the tumor is a cancer selected from the group consisting of kidney cancer, colon cancer, lung cancer, liposarcomas, brain cancer, breast cancer, melanoma, liver cancer, head and neck cancer, and prostate cancer.
6. The composition according to claim 1 , wherein the monoclonal antibody or antigen binding fragment thereof comprises:
(1) a VH polypeptide encoded by:
(SEQ ID NO: 15)
gaggtgcagctggtggagtctgggggaggcgtggtccagcctgggaggtc
cgtgagactctcctgtgcagcctctggattcaccttcagtacctatacta
tgcactgggtccgccaggctccaggcaaggggctggagtgggtggcaatt
atctcaaatgatggaagcaataagtactacgcagaccccgtgaggggccg
attcaccatctccagagacaattccaagaacacgctgtatctgcaaatga
acagcctgagagctgaggacacggctgtgtattactgtgtacgtggcagc
agctggtatcgcggaaattggttcgacccctggggccagggaaccctggt
caccgtgagctca
and
(2) a VL polypeptide encoded by:
(SEQ ID NO: 16)
gacatccagatgacccagtctccatcctccctgtctgcatctgtaggaga
cagagtcaccatcgcttgccgggcaagtcagaccattagtaggtatttaa
attggtatcagcagaaaccagggaaagcccctaagctcctgatctatgct
gcatccagtttgcaaagtggggtctcatcaaggttcagtggcagtggatc
tgggacagagttcactctcaccatcagcagtctgcagcctgaagattttg
caacttatttctgtcaacagacttacagtcccccgatcaccttcggccaa
gggacacgactggagattaaacga.
7. A composition for treating a tumor in a human subject comprising:
(a) a topoisomerase inhibitor; and
(b) a monoclonal antibody or antigen binding fragment thereof, wherein the monoclonal antibody comprises:
(i) a heavy chain variable region (VH), which comprises an amino acid sequence of SEQ ID NO:5; and
(ii) a light chain variable region (VL), which comprises an amino acid sequence of SEQ ID NO:6 wherein the monoclonal antibody or antigen binding fragment thereof binds to human tumor endothelial marker 8 (TEM8);
wherein the tumor comprises one or more of human TEM8 expressing tumor cells and human TEM8 expressing tumor stromal cells; and wherein the topoisomerase inhibitor is selected from the group consisting of: Adva-27a, zoptarelin doxorubicin, valrubicin, razoxane, doxorubicin, amsacrine, etoposide phosphate, etoposide, dexrazoxane, cytarabine/daunorubicin combination, CAP7.1, aldoxorubicin, amrubicin hydrochloride, vosaroxin, daunorubicin, milatuzumab/doxorubicin combination, aclarubicin, mitoxantrone, pirarubicin, epirubicin, teniposide, F-14512, elliptinium acetate, zorubicin, dexrazoxane, sobuzoxane, idarubicin, HU-331, aurintricarboxylic acid, pharmaceutically acceptable salts thereof, and combinations thereof.
8. A pharmaceutical composition comprising the composition of claim 1 and a pharmaceutically acceptable diluent or carrier.
9. A kit comprising the composition of claim 1 packaged together with instructions for its use.
10. A kit comprising the pharmaceutical composition of claim 8 packaged together with instructions for its use.