IP Library Granted Patent US 11,136,597
Granted Patent B2
US 11,136,597 · App. 15/434,978 · Granted Oct 5, 2021

Compositions for enhancing targeted gene editing and methods of use thereof

Inventors: W. Mark Saltzman (New Haven, CT); Peter Glazer (Guilford, CT); Raman Bahal (Hamden, CT); Nicole Ali McNeer (Westport, CT); Danith H. Ly (Pittsburgh, PA); Elias Quijano (New Haven, CT)
Assignees: Yale University; Carnegie Mellon University
C12N15/907A61K9/1647A61K48/005C07K14/003C12N15/102C12N15/11C12N15/111C12N15/113C12N2310/15C12N2310/152C12N2310/318C12N2310/3181C12N2310/334C12N2310/351C12N2310/3519
View Patent ↗
Loading inventors, assignments & file history…
Monitor This Case
Get email alerts when status or documents change.
Order Certified Copies
Most orders are placed with the USPTO same day — all within 24 business hours.
Order via The Patent Place →
Pre-filled with this patent's details
Quick Facts
Patent No.
US 11,136,597
App. No.
15/434,978
Granted
Oct 5, 2021
Kind
B2
Abstract

Compositions and methods for enhancing targeted gene editing and methods of use thereof are disclosed. In the most preferred embodiments, gene editing is carried out utilizing a gene editing composition such as triplex-forming oligonucleotides, CRISPR, zinc finger nucleases, TALENS, or others, in combination with a gene modification potentiating agent such as stem cell factor (SCF), a CHK1 or ATR inhibitor, or a combination thereof. A particular preferred gene editing composition is triplex-forming peptide nucleic acids (PNAs) substituted at the γ position for increased DNA binding affinity. Nanoparticle compositions for intracellular delivery of the gene editing composition are also provided and particular advantageous for use with in vivo applications.

Claims (157)

1. A method of modifying the genomes of CD117+ cells comprising contacting the CD117+ cells with an effective amount of

(i) a gene editing potentiating agent selected from the group consisting of receptor tyrosine kinase C-kit ligands, ATR-Chk1 cell cycle checkpoint pathway inhibitors, and heat shock protein 90 inhibitors (HSP90i), and

(ii) a gene editing technology that can induce genomic modification through a mechanism comprising a DNA repair pathway endogenous to the CD117+ cells,

to modify the genomes of the CD117+ cells contacted with both (i) and (ii) at a higher frequency than an equivalent population of cells contacted with (ii) in the absence of (i).

2. The method of claim 1 further comprising contacting the cells with a donor oligonucleotide comprising a sequence that corrects a mutation(s) in the cells' genomes by insertion or recombination induced or enhanced by the gene editing technology.

3. The method of claim 2 , wherein the cells' genomes have a mutation underlying a disease or disorder.

4. The method of claim 3 , wherein the disease is a globinopathy.

5. The method of claim 3 , wherein the disease is a lysosomal storage disease.

6. The method of claim 1 further comprising contacting the cells with a donor oligonucleotide comprising a sequence that induces a mutation(s) in the cells' genomes by insertion or recombination induced or enhanced by the gene editing technology.

7. The method of claim 2 , wherein the cells are hematopoietic stem cells.

8. The method of claim 2 , wherein the contacting occurs in vivo following administration of (i), (ii), and the donor oligonucleotide to a subject in need thereof.

9. The method of claim 8 , wherein the subject has a disease or disorder.

10. The method of claim 8 , wherein (i), (ii), the donor oligonucleotide or a combination thereof are packaged together or separately in nanoparticles.

11. The method of claim 10 , wherein the nanoparticles comprise poly(lactic-co-glycolic acid) (PLGA).

12. The method of claim 1 , wherein the gene editing potentiating agent is a receptor tyrosine kinase C-kit ligand.

13. A method of modifying the genomes of CD117+ cells comprising contacting the CD117+ cells with an effective amount of

(i) a gene editing potentiating agent selected from the group consisting of receptor tyrosine kinase C-kit ligands, ATR-Chk1 cell cycle checkpoint pathway inhibitors, and heat shock protein 90 inhibitors (HSP90i), and

(ii) a triplex forming composition comprising a peptide nucleic acid (PNA), wherein one or more of the PNA monomers is a γPNA,

to modify the genomes of the cells contacted with both (i) and (ii) at a higher frequency than an equivalent population of cells contacted with (ii) in the absence of (i).

14. An isolated population of cells treated according to the method of claim 2 .

15. The method of claim 1 , wherein the gene editing technology is a triplex forming molecule.

16. The method of claim 15 , wherein the triplex forming molecule comprises a peptide nucleic acid (PNA) comprising:

(a) a Hoogsteen binding PNA segment;

(b) a Watson-Crick binding PNA segment; and

(c) a γPNA monomer.

17. The method of claim 16 , wherein (a) and (b) are linked by a linker.

18. The method of claim 16 , wherein the PNA comprises a polyethylene glycol moiety.

19. The method of claim 16 , wherein the triplex forming molecule is a tail-clamp PNA.

20. The method of claim 16 , wherein the Hoogsteen binding segment comprises a chemically modified cytosine.

21. The method of claim 15 , wherein the cells comprise a genome encoding a human beta-globin gene,

the triplex forming molecule forms a triplex at the cells' genomic beta-globin locus and,

the triplex forming molecule comprises a Hoogsteen binding peptide nucleic acid (PNA) segment and a Watson-Crick binding PNA segment, wherein

(i) the Hoogsteen binding segment comprises the sequence JTTTJTTTJTJT (SEQ ID NO:30) and the Watson-Crick binding segment comprises the sequence TCTCTTTCTTTC (SEQ ID NO:22) or TCTCTTTCTTTCAGGGCA (SEQ ID NO:23);

(ii) the Hoogsteen binding segment comprises the sequence TTTTJJJ (SEQ ID NO:31) and the Watson-Crick binding segment comprises the sequence CCCTTTT (SEQ ID NO:25) or CCCTTTTGCTAATCATGT (SEQ ID NO:26);

(iii) the Hoogsteen binding segment comprises the sequence TTTJTJJ (SEQ ID NO:32) and the Watson-Crick binding segment comprises the sequence CCTCTTT (SEQ ID NO:28) or CCTCTTTGCACCATTCT (SEQ ID NO:29);

(iv) the Hoogsteen binding segment comprises the sequence TJTTTTJTTJ (SEQ ID NO:36) and the Watson-Crick binding segment comprises the sequence CTTCTTTTCT (SEQ ID NO:37);

(v) the Hoogsteen binding segment comprises the sequence TTJTTJTTTJ (SEQ ID NO:38) and the Watson-Crick binding segment comprises the sequence CTTTCTTCTT (SEQ ID NO:39);

(vi) the Hoogsteen binding segment comprises the sequence JJJTJJTTJT (SEQ ID NO:40) and the Watson-Crick binding segment comprises TCTTCCTCCC (SEQ ID NO:41);

(vii) the Hoogsteen binding segment comprises the sequence JJTJTTJ (SEQ ID NO:56) and the Watson-Crick binding segment comprises the sequence CTTCTCC (SEQ ID NO:46) or CTTCTCCAAAGGAGT (SEQ ID NO:47) or CTTCTCCACAGGAGTCAG (SEQ ID NO:48) or CTTCTCCACAGGAGTCAGGTGC (SEQ ID NO:205);

(viii) the Hoogsteen binding segment comprises the sequence TTJJTJT (SEQ ID NO:214) and the Watson-Crick binding segment comprises the sequence TCTCCTT (SEQ ID NO:50) or TCTCCTTAAACCTGT (SEQ ID NO:51) or TCTCCTTAAACCTGTCTT (SEQ ID NO:212); or

(ix) the Hoogsteen binding segment comprises the sequence TJTJTTJT (SEQ ID NO:215) and the Watson-Crick binding segment comprises the sequence TCTTCTCT (SEQ ID NO:53) or TCTTCTCTGTCTCCAC (SEQ ID NO:54) or TCTTCTCTGTCTCCACAT (SEQ ID NO:55);

wherein “J” is pseudoisocytosine, and

wherein the two segments are optionally linked by a linker.

22. The method of 21 , wherein the triplex forming molecule comprises a sequence selected from:

(i)

(SEQ ID NO: 33)

lys-lys-lys-JTTTJTTTJTJT-OOO-T C T C T T T C T T T C A G G G C A -

lys-lys-lys;

(ii)

(SEQ ID NO: 34)

lys-lys-lys-TTTTJJJ-OOO-C C C T T T T G C T A A T C A T G T -lys-

lys-lys;

(iii)

(SEQ ID NO: 35)

lys-lys-lys-TTTJTJJ-OOO-C C T C T T T G C A C C A T T C T-lys-

lys-lys,

(iv)

(SEQ ID NO: 42)

lys-lys-lys-TJTTTTJTTJ-OOO-C T T C T T T T C T -lys-lys-lys

(IVS2-24);

(v)

(SEQ ID NO: 43)

lys-lys-lys-TTJTTJTTTJ-OOO-C T T T C T T C T T -lys-lys-lys

(IVS2-512);

(vi)

(SEQ ID NO: 44)

lys-lys-lys-JJJTJJTTJT-OOO-T C T T C C T C C C -lys-lys-lys

(IVS2-830);

(vii)

(SEQ ID NO: 160)

lys-lys-lys-JJTJTTJ-OOO-C T T C T C C A A A G G A G T-lys-lys-

lys;

(viii)

(SEQ ID NO: 57)

lys-lys-lys-TTJJTJT-OOO-T C T C C T T A A A C C T G T-lys-lys-

lys;

(ix)

(SEQ ID NO: 213)

lys-lys-lys-TTJJTJT-OOO-T C T C C T T A A A C C T G T C T T -lys-

lys-lys

(x)

(SEQ ID NO: 58)

lys-lys-lys-TJTJTTJT-OOO-T C T T C T C T G T C T C C A C -lys-

lys-lys (tc816);

(xi)

(SEQ ID NO: 59)

lys-lys-lys-JJTJTTJ-OOO-C T T C T C C A C A G G A G T C A G -lys-

lys-lys;

(xii)

(SEQ ID NO: 59)

lys-lys-lys-JJTJTTJ-OOO- C T T C T C C A C A G G A G T C A G-lys-

lys-lys (SCD-tcPNA 1A);

(xiii)

(SEQ ID NO: 59)

lys-lys-lys-JJTJTTJ-OOO- CTTCTCCACAGGAGTCAG -lys-

lys-lys (SCD-tcPNA 1B);

(xiv)

(SEQ ID NO: 59)

lys-lys-lys-JJ T J TT J-OOO- CTTCTCCACAGGAGTCAG -lys-

lys-lys (SCD-tcPNA 1C);

(xv)

(SEQ ID NO: 209)

lys-lys-lys-JJTJTTJ-OOO- C T T C T C C A C A G G A G T C A G G T G C-

lys-lys-lys (SCD-tcPNA 1D);

(xvi)

(SEQ ID NO: 209)

lys-lys-lys-JJTJTTJ-OOO- CTTCTCCACAGGAGTCAGGTGC -

lys-lys-lys (SCD-tcPNA 1E);

(xvii)

(SEQ ID NO: 209)

lys-lys-lys-JJ T J TT J-OOO- CTTCTCCACAGGAGTCAGGTGC -

lys-lys-lys (SCD-tcPNA 1F);

(xviii)

(SEQ ID NO: 60)

lys-lys-lys-TJTJTTJT-OOO-T C T T C T C T G T C T C C A C A T -lys-

lys-lys;

wherein each “lys” is the amino acid lysine, each “J” is pseudoisocytosine, each “0” is selected from 8-amino-3,6-dioxaoctanoic acid, 6-aminohexanoic acid, and 8-amino-2,6,10-trioxaoctanoic acid, and the bolded and underlined residues are miniPEG-containing γPNA residues.

23. The method of claim 15 , wherein the cells comprise a genome encoding a human cystic fibrosis transmembrane conductance regulator (CFTR) gene,

the triplex forming molecule forms a triplex at the genomic locus of the CFTR gene and

the triplex forming molecule comprises a Hoogsteen binding peptide nucleic acid (PNA) segment and a Watson-Crick binding PNA segment, wherein

(i) the Hoogsteen binding segment comprises the sequence JTTJJTJTTT (SEQ ID NO:106) and the Watson-Crick binding segment comprises the sequence TTTCTCCTTC (SEQ ID NO:98) or TTTCTCCTTCAGTGTTCA (SEQ ID NO:99);

(ii) the Hoogsteen binding segment comprises the sequence TTTTJJT (SEQ ID NO:107) and the Watson-Crick binding segment comprises the sequence TCCTTTT (SEQ ID NO:101) or TCCTTTTGCTCACCTGTGGT (SEQ ID NO:102);

(iii) the Hoogsteen binding segment comprises the sequence TJTTTTTTJJ (SEQ ID NO:108) and the Watson-Crick binding segment comprises the sequence CCTTTTTTCT (SEQ ID NO:104) or CCTTTTTTCTGGCTAAGT (SEQ ID NO:105);

(iv) the Hoogsteen binding segment comprises the sequence TJTTTTT (SEQ ID NO:118) Watson-Crick binding segment comprises the sequence TTTTTCT (SEQ ID NO:111) or TTTTTCTGTAATTTTTAA (SEQ ID NO:112);

(v) the Hoogsteen binding segment comprises the sequence TJTJTTTJT (SEQ ID NO:119) and the Watson-Crick binding segment comprises the sequence TCTTTCTCT (SEQ ID NO:114) or TCTTTCTCTGCAAACTT (SEQ ID NO:115); or

(vi) the Hoogsteen binding segment comprises the sequence TTTJTTT (SEQ ID NO:120) and the Watson-Crick binding segment comprises the sequence TTTCTTT (SEQ ID NO:116) or TTTCTTTAAGAACGAGCA (SEQ ID NO:117);

wherein “J” is pseudoisocytosine, and

wherein the two segments are optionally linked by a linker.

24. The method of claim 23 , wherein the triplex forming molecule comprises a sequence selected from:

(i)

lys-lys-lys-JTTJJTJTTT-OOO-TTTCTCCTTCAGTGTTCA-lys-lys-lys;

(SEQ ID NO: 155)

(ii)

lys-lys-lys-TTTTJJT-OOO-TCCTTTTGCTCACCTGTGGT-lys-lys-lys;

(SEQ ID NO: 156)

(iii)

lys-lys-lys-TJTTTTTTJJ-OOO-CCTTTTTTCTGGCTAAGT-lys-lys-lys;

(SEQ ID NO: 157)

(iv)

lys-lys-lys-TJTTTTT-OOO-TTTTTCTGTAATTTTTAA-lys-lys-lys;

(SEQ ID NO: 121)

(v)

lys-lys-lys-TJTJTTTJT-OOO-TCTTTCTCTGCAAACTT-lys-lys-lys;

(SEQ ID NO: 122)

(vi)

lys-lys-lys-TTTJTTT-OOO-TTTCTTTAAGAACGAGCA-lys-lys-lys; and

(SEQ ID NO: 123)

(vii)

lys-lys-lys-TJTJJTTT-OOO-TTTCCTCTATGGGTAAG-lys-lys-lys

(SEQ ID NO: 93)

wherein each “lys” is the amino acid lysine, each “J” is pseudoisocytosine, each “0” is selected from 8-amino-3,6-dioxaoctanoic acid, 6-aminohexanoic acid, and 8-amino-2,6,10-trioxaoctanoic acid, and the bolded and underlined residues are miniPEG-containing γPNA residues.

25. The method of claim 3 , wherein the disease is cystic fibrosis.

26. The method of claim 1 , wherein DNA repair pathway is the homology-dependent repair (HDR) pathway.

27. The method of claim 1 , wherein the gene editing technology comprises an enzyme that induces a single or double strand break in cells' genomes.

28. The method of claim 27 , wherein the enzyme is a Cas endonuclease, zinc finger nuclease (ZFN), transcription activator-like effector nucleases (TALEN), or intron encoded meganuclease.

29. The method of claim 13 , further comprising contacting the cells with a donor oligonucleotide comprising a sequence that introduces or corrects a mutation(s) in the cells' genomes by insertion or recombination induced or enhanced by the triplex forming composition.

30. The method of claim 13 , wherein the gene editing potentiating agent is a receptor tyrosine kinase C-kit ligand.

Assignments (3)
CONFIRMATORY LICENSE Recorded Nov 5, 2019
From: YALE UNIVERSITY
To: NATIONAL SCIENCE FOUNDATION
Reel/Frame 050930/0383 →
ASSIGNMENT OF ASSIGNOR'S INTEREST Recorded Oct 13, 2018
From: SALTZMAN, W. MARK; GLAZER, PETER; BAHAL, RAMAN; MCNEER, NICOLE ALI; QUIJANO, ELIAS
To: YALE UNIVERSITY
Reel/Frame 047155/0618 →
ASSIGNMENT OF ASSIGNOR'S INTEREST Recorded Oct 13, 2018
From: LY, DANITH H.
To: CARNEGIE MELLON UNIVERSITY
Reel/Frame 047155/0627 →
Continuity (2)
Provisional Application 62295789 · Feb 16, 2016
Related Publication 20170283830A1 · Oct 5, 2017
Cited By (5)
US 12,268,774 US 12,441,814 US 12,485,180 US 12,486,519 US 12,496,357