IP Library Granted Patent US 11,045,543
Granted Patent B2
US 11,045,543 · App. 15/564,166 · Granted Jun 29, 2021

EGFR-directed car therapy for glioblastoma

Inventors: Jianhua Yu (Columbus, OH); Michael Caligiuri (Columbus, OH)
Assignee: CYTOIMMUNE THERAPEUTICS, INC.
A61K39/395A61K39/001104A61P35/00C07K14/7051C07K14/70521C07K16/2863C07K16/30A61K2039/5156A61K2039/5158A61K2039/80C07K2317/622C07K2319/03C07K2319/33C12N2740/15043
View Patent ↗
Loading inventors, assignments & file history…
Monitor This Case
Get email alerts when status or documents change.
Order Certified Copies
Most orders are placed with the USPTO same day — all within 24 business hours.
Order via The Patent Place →
Pre-filled with this patent's details
Quick Facts
Patent No.
US 11,045,543
App. No.
15/564,166
Granted
Jun 29, 2021
Kind
B2
Abstract

Glioblastoma (GB) remains the most aggressive primary brain malignancy; brain metastasis, such as breast cancer brain metastases (BCBMs), are also aggressive and are associated with poor prognosis. Adoptive transfer of chimeric antigen receptor (CAR)-modified immune cells has emerged as a promising anti-cancer approach, yet the potential utility of CAR-engineered cells to treat brain cancers has not been explored. The present disclosure presents compostions and methods for using CAR expressing cells in the treatment of various cancers, including brain cancers such as GB and BCBMs.

Claims (47)

1. A chimeric antigen receptor (CAR) comprising: (a) an antigen binding domain of an anti-Epidermal Growth Factor Receptor (anti-EGFR) antibody that recognizes both wild type Epidermal Growth Factor Receptor (wtEGFR) and Epidermal Growth Factor Receptor variant III mutant (EGFRvIII), wherein the antigen binding domain comprises the three complementarity determining regions (CDRs) of an anti-EGFR heavy chain (HC) variable region of:

(SEQ ID NO: 24)

Q V Q L Q Q S G S E M A R P G A S V K L P C K A S

G D T F T S Y W M H W V K Q R H G H G P E W I G N

I Y P G S G G T N Y A E K F K N K V T L T V D R S

S R T V Y M H L S R L T S E D S A V Y Y C T R S G

G P Y F F D Y W G Q G T T L T V S S;

and the CDRs of an anti-EGFR light chain (LC) variable region of:

(SEQ ID NO: 26)

D I L M T Q S P L S L P V S L G D Q A S I S C R S

S Q N I V H N N G I T Y L E W Y L Q R P G Q S P K

L L I Y K V S D R F S G V P D R F S G S G S G T D

F T L K I S R V E A E D L G I Y Y C F Q G S H I P

P T F G G G T K L E I K R A A;

(b) a hinge domain polypeptide; (c) a costimulatory molecule or polypeptide; and (d) a CD3 zeta signaling domain.

2. The CAR of claim 1 , wherein the costimulatory molecule comprises a molecule or polypeptide selected from the group of: a 4-1BB costimulatory signaling region, a CD28 costimulatory molecule, OX40, ICOS and CD27.

3. The CAR of claim 1 , wherein the antigen binding domain of the anti-EGFR antibody comprises an anti-EGFR heavy chain (HC) variable region comprising the amino acid sequence of SEQ ID NO: 24 or an equivalent thereof having at least 80% identity to SEQ ID NO: 24; and an anti-EGFR light chain (LC) variable region comprising the amino acid sequence of SEQ ID NO: 26 or an equivalent thereof having at least 80% identity to SEQ ID NO: 26.

4. The CAR of claim 3 , further comprising a linker polypeptide located between the anti-EGFR HC variable region and the anti-EGFR LC variable region.

5. The CAR of claim 4 , wherein the linker polypeptide comprises SEQ ID NO:22 (GGGGSGGGGSGGGG).

6. The CAR of claim 1 , further comprising a signal polypeptide to the amino terminus of the antigen binding domain.

7. The CAR of claim 1 , wherein the hinge polypeptide is encoded by a polynucleotide that comprises SEQ ID NO:1 (CTCGAGCCCAAATCTTGTGACAAAACTCACACATGCCCACCGTGCCCG).

8. The CAR of claim 2 , wherein the CD28 costimulatory molecule comprises a CD28 transmembrane domain and a CD28 intracellular domain.

9. The CAR of claim 1 , further comprising a detectable marker or a purification marker attached to the CAR.

10. An isolated nucleic acid encoding the CAR of claim 1 .

11. A vector comprising the isolated nucleic acid sequence of claim 10 , that is optionally a plasmid or a viral vector.

12. The vector of claim 11 , wherein the viral vector is selected from a group consisting of a retroviral vector, a lentiviral vector, an adenoviral vector, and an adeno-associated viral vector.

13. The vector of claim 11 , further comprising a detectable label or a purification marker, wherein the detectable label optionally is not a naturally occurring polynucleotide.

14. An isolated cell comprising the CAR of claim 1 , that is optionally a prokaryotic cell or a eukaryotic cell.

15. An isolated cell comprising the isolated nucleic acid of claim 10 .

16. An isolated cell comprising the vector of claim 11 .

17. The isolated cell of claim 15 , wherein the cell is a prokaryotic or a eukaryotic cell.

18. The isolated cell of claim 16 , wherein the cell is a prokaryotic or a eukaryotic cell.

19. The isolated cell of claim 17 , wherein the eukaryotic cell is selected from an animal cell, a mammalian cell, a bovine cell, a feline cell, a canine cell, a murine cell, an equine cell or a human cell.

20. The isolated cell of claim 18 , wherein the eukaryotic cell is selected from an animal cell, a mammalian cell, a bovine cell, a feline cell, a canine cell, a murine cell, an equine cell or a human cell.

21. The isolated cell of claim 14 , wherein the cell is selected from the group of a T-cell, a natural killer (NK) cell, a natural killer T-cell, a stem cell, or a leukocyte derived from hematopoietic stem cells (HSC).

22. The isolated cell of claim 19 , wherein the cell is selected from the group of a T-cell, a natural killer (NK) cell, a natural killer T-cell, a stem cell, or a leukocyte derived from hematopoietic stem cells (HSC).

23. The isolated cell of claim 20 , wherein the cell is selected from the group of a T-cell, a natural killer (NK) cell, a natural killer T-cell, a stem cell, or a leukocyte derived from hematopoietic stem cells (HSC).

24. An isolated complex comprising the CAR of claim 1 and a wtEGFR protein or a fragment thereof or an EGFRvIII protein or a fragment thereof.

25. An isolated complex comprising the CAR of claim 1 and a cell expressing a wtEGFR or an EGFRvIII.

26. A composition comprising a carrier and one or more of the CAR of claim 1 , an isolated cell comprising the CAR, an isolated nucleic acid encoding the CAR, or a vector comprising the isolated nucleic acid.

27. The composition of claim 26 , wherein the carrier is a pharmaceutically acceptable carrier or a solid support.

28. A kit for treating cancer, comprising the CAR of claim 1 and instructions for use, optionally with an oncolytic herpes virus.

29. The isolated cell of claim 14 , wherein the cell is a natural killer (NK) cell.

30. The isolated cell of claim 19 , wherein the cell is a natural killer (NK) cell.

31. The isolated cell of claim 20 , wherein the cell is a natural killer (NK) cell.

32. The CAR of claim 1 , wherein the antigen binding domain of the anti-EGFR antibody comprises an anti-EGFR heavy chain (HC) variable region that consists of the amino acid sequence of SEQ ID NO: 24 or an equivalent thereof and an anti-EGFR light chain (LC) variable region that consists of the amino acid sequence of SEQ ID NO: 26, or an equivalent of thereof.

33. The CAR of claim 32 , further comprising a linker polypeptide located between the HC variable region and the LC variable region.

Assignments (1)
CHANGE OF NAME Recorded May 18, 2021
From: CYTOIMMUNE THERAPEUTICS, LLC
To: CYTOIMMUNE THERAPEUTICS, INC.
Reel/Frame 056281/0918 →
Continuity (2)
Provisional Application 62143744 · Apr 6, 2015
Related Publication 20180117146A1 · May 3, 2018