Methods for detecting enhanced NMDA receptor function and uses thereof

1. A method comprising:

a) detecting in an mRNA transcript including a GRIN2B nucleic acid sequence from a biological sample obtained from a human subject the absence of an A allele at SNP rs3764030 using sequencing, hybridization or an amplification technique and

b) administering to the human subject without an A allele at SNP rs3764030 a therapeutically effective amount of memantine.

2. The method of claim 1 , wherein detecting in the mRNA transcript comprises:

obtaining a biological sample from the human subject.

3. The method of claim 1 , wherein the A allele is detected by hybridization of a probe specific to the A allele.

4. The method of claim 3 , wherein the probe comprises SEQ ID NO:6 (CATCTCCGGGGAACACGCGAA).

5. The method of claim 1 , further comprising determining efficacy of the memantine.

6. The method of claim 1 , further comprising determining an amount of expression of the GRIN2B nucleic acid sequence.

7. The method of claim 6 , wherein determining the amount of expression includes at least one of arrays, polymerase chain reaction, nuclease protection assays, and Northern blot analyses.

8. The method of claim 1 , wherein the amplification techniques include at least one of polymerase chain reaction, ligase chain reaction, nucleic acid sequence based amplification, strand displacement amplification, transcription mediated amplification, loo-mediated isothermal amplification, Q-beta replicase, rolling circle amplification, 3SR, ramification amplification, multiplex ligation-dependent probe amplification, restriction fragment length polymorphism, single strand conformation polymorphism, and denaturing high performance liquid chromatography.