IP Library Granted Patent US 10,273,480
Granted Patent B2
US 10,273,480 · App. 15/614,665 · Granted Apr 30, 2019

MCP-1 binding nucleic acids

Inventors: Werner Purschke (Berlin, DE); Florian Jarosch (Berlin, DE); Dirk Eulberg (Berlin, DE); Sven Klussmann (Berlin, DE); Klaus Buchner (Berlin, DE); Christian Maasch (Berlin, DE)
Assignee: NOXXON Pharma AG
C12N15/1136C12N15/115C12Q1/6813G01N33/566C12N2310/16C12N2310/351
View Patent ↗
Loading inventors, assignments & file history…
Monitor This Case
Get email alerts when status or documents change.
Order Certified Copies
Most orders are placed with the USPTO same day — all within 24 business hours.
Order via The Patent Place →
Pre-filled with this patent's details
Quick Facts
Patent No.
US 10,273,480
App. No.
15/614,665
Granted
Apr 30, 2019
Kind
B2
Abstract

The present invention is related to a nucleic acid, preferably binding to MCP-1, selected from the group comprising type 1A nucleic acids, type 1B nucleic acids, type 2 nucleic acids, type 3 nucleic acids, type 4 nucleic acids and nucleic acids having a nucleic acid sequence according to any of SEQ.ID.No. 87 to 115.

Claims (23)

1. A method for treating a subject with a kidney disease, comprising administering to said subject an L-nucleic acid that binds a chemokine, wherein said nucleic acid comprises in 5′→3′ direction a first stretch Box B1A, a second stretch Box B2, and a third stretch Box B1B, wherein said first stretch Box B1A comprises a nucleotide sequence selected from the group consisting of ACGCA, CGCA and GCA, said second stretch Box B2 comprises CSUCCCUCACCGGUGCAAGUGAAGCCGYGGCUC (SEQ ID NO:287), and said third stretch Box B1B comprises a nucleotide sequence selected from the group consisting of UGCGU, UGCG and UGC; or a homolog of said L-nucleic acid comprising at least 85% homology.

2. The method of claim 1 , wherein said second stretch Box B2 comprises GUCCCUCACCGGUGCAAGUGAAGCCGUGGCUC (SEQ ID NO:288).

3. The method of claim 1 , wherein

a) said first stretch Box B1A comprises ACGCA, and said third stretch Box B1B comprises UGCGU;

b) said first stretch Box B1A comprises CGCA, and said third stretch Box B1B comprises UGCG; or

c) said first stretch Box B1A comprises GCA, and said third stretch Box B1B comprises UGC or UGCG.

4. The method of claim 1 , wherein said first stretch Box B1A comprises GCA.

5. The method of claim 1 , wherein said third stretch Box B1B comprises UGCG.

6. The method of claim 1 , wherein said chemokine is selected from the group consisting of eotaxin, MCP-1, MCP-2 and MCP-3.

7. The method of claim 1 , wherein said chemokine is human MCP-1.

8. The method of claim 1 , comprising a modification.

9. The method of claim 8 , wherein said modification comprises a hydroxyethyl starch (HES) moiety or a polyethylene glycol (PEG) moiety.

10. The method of claim 8 , wherein said modification comprises a straight or a branched PEG.

11. The method of claim 10 , wherein said straight or branched PEG has a molecular weight from about 20 kD to about 120 kD.

12. The method of claim 9 , wherein said HES moiety has a molecular weight from about 10 kD to about 130 kD.

13. The method of claim 1 , wherein said first stretch Box B1A and said third stretch Box B1B optionally hybridize with each other to form a double-stranded structure.

14. The method of claim 1 , wherein said nucleic acid comprises SEQ ID NO:37, SEQ ID NO:116, SEQ ID NO:117 or SEQ ID NO:278.

15. The method of claim 1 , further comprising administering to said subject a second agent.

16. The method of claim 1 , wherein said disease is autoimmune.

17. The method of claim 1 , wherein said disease is chronic.

18. The method of claim 1 , wherein said disease comprises diabetes.

19. The method of claim 1 , wherein said disease comprises inflammation.

20. The method of claim 1 , wherein said disease comprises albuminuria.

Assignments (2)
CHANGE OF NAME Recorded Jan 26, 2023
From: NOXXON PHARMA AG
To: TME PHARMA AG
Reel/Frame 062489/0829 →
RELEASE OF SECURITY INTEREST Recorded Feb 7, 2020
From: KREOS CAPITAL IV (UK) LIMITED
To: NOXXON PHARMA AG
Reel/Frame 051757/0649 →
Priority Claims (2)
EP 06002935 · Feb 14, 2006 · regional
EP 06024202 · Nov 22, 2006 · regional
Continuity (4)
Continuation 14246134 · Apr 6, 2014
Division 13487341 · Jun 4, 2012
Continuation 12279183
Related Publication 20180066265A1 · Mar 8, 2018