Epigenetic chromosome interactions

1. A method of selecting a human subject and treating the selected human subject, wherein the selected human subject is responsive to a specific therapy for rheumatoid arthritis and is in need of therapy for rheumatoid arthritis, and wherein the method comprises detecting the presence or absence of a first, second, third, fourth and fifth chromosomal interaction in a sample from the human subject, wherein selecting the human subject as responsive to the specific therapy is based on detection of:

the absence of a first chromosomal interaction,

the presence of a second chromosomal interaction,

the absence of a third chromosomal interaction,

the presence of a fourth chromosomal interaction, and

the presence of a fifth chromosomal interaction;

and treating the selected human subject for rheumatoid arthritis by administering to the selected human subject the specific therapy,

wherein said detecting is carried out by

(a) cross-linking of chromosome regions in the sample from the human subject which have come together in a chromosome interaction;

(b) subjecting said cross-linked regions to cleavage;

(c) ligating said cross-linked cleaved DNA ends to form ligated nucleic acids; and

(d) detecting the presence or absence of the ligated nucleic acids to thereby detect

whether regions have been brought together in a chromosome interaction;

wherein:

the first chromosomal interaction is on chromosome 4 in the CXCL13 gene and the ligated nucleic acid corresponding to the first chromosomal interaction is detected by the probe sequence: TTATATCTCCTACCTCCAAGCCTGGCAGTCGATTCCAAAGTGAAGCAAAAAAAAAAC TTC (SEQ ID NO: 99),

the second chromosomal interaction is on chromosome 21 in the IFNAR1 gene and the ligated nucleic acid corresponding to the second chromosomal interaction is detected by the probe sequence: GTGCAGAGCGAGAGCGGGGCAGAGGCGGTCGAAACTGGGAGAATTCATCTGAAAT GATTA (SEQ ID NO: 75),

the third chromosomal interaction is on chromosome 6 in the IL-17A gene and the ligated nucleic acid corresponding to the third chromosomal interaction is detected by the probe sequence: CCCTCCCTCAACATGCAGGGATTACAATTCGAAGATGGTCTGAAGGAAGCAATTGG GAAA (SEQ ID NO: 103),

the fourth chromosomal interaction is on chromosome 16 in the IL-21R gene and the ligated nucleic acid corresponding to the fourth chromosomal interaction is detected by the probe sequence: GAGGCAGGCAGATCATGAGGTCAGGAGTTCGAGCCCTGGACCCCAGGCCAGCTAAT GAGG (SEQ ID NO: 76), and

the fifth chromosomal interaction is on chromosome 12 in the IL-23 gene and the ligated nucleic acid corresponding to the fifth chromosomal interaction is detected by the probe sequence: AGTGGCATGATCACAGCTCACTGCCACCTCGAAACCAAACCCTGTGACTTCAACACC CAA (SEQ ID NO: 102),

and wherein the specific therapy comprises methotrexate or a pharmaceutically acceptable salt thereof.