Detection of chromosome interactions

1. A method of typing a human comprising detecting the presence or absence of the following 5 epigenetic chromosome interactions which relate to predisposition to amyotrophic lateral sclerosis (ALS) disease

(i) the chromosome interaction formed by chromosome positions 171936106 to 171936135 coming together with chromosome positions 171992917 to 171992948 on chromosome 1;

(ii) the chromosome interaction formed by chromosome positions 25106841 to 25106870 coming together with chromosome positions 25144195 to 25144224 on chromosome 1;

(iii) the chromosome interaction formed by chromosome positions 80060926 to 80060955 coming together with chromosome positions 80301398 to 80301429 on chromosome 7;

(iv) the chromosome interaction formed by chromosome positions 54983094 to 54983123 coming together with chromosome positions 55002282 to 55002311 on chromosome 12; and

(v) the chromosome interaction formed by chromosome positions 198660143 to 198660172 coming together with chromosome positions 198737980 to 198738009 on chromosome 1.

2. A method of treatment and/or prophylaxis of a human comprising administering a therapeutic agent for ALS disease to the individual wherein said individual has been identified as being in need of said therapeutic agent by the method of claim 1 .

3. The method according to claim 1 , wherein detecting of the presence or absence of the chromosome interactions is by a method comprising the steps of:

(i) in vitro cross-linking of chromosome regions which have come together in a chromosome interaction;

(ii) subjecting said cross-linked DNA to restriction digestion cleavage with an enzyme; and

(iii) ligating said cross-linked cleaved DNA ends to form the ligated nucleic acids.

4. The method according to claim 3 , wherein said ligated DNA is detected by PCR or by use of a probe.

5. The method according to claim 4 , wherein said probe has at least 70% identity to any of the following probes

(SEQ ID NO: 716)

TCTCTTTGGAATGTCAGTTATTCAAATATC

GAATAGCTCCTATTGTTATGGAGTGTAGCA;

(SEQ ID NO: 717)

TATCTCAGCTTTTGGCCTGTCTCAGCTTTC

GACATAGTAGGTACTTGGTAAACATTTGTT;

(SEQ ID NO: 712) 

AAATACAATTGAAATAAAAATAATCTTGTC

GAAGCAAGGGCTTCCAGGTCATAGGTGGAT;

(SEQ ID NO: 152) 

CCCCTAATTTAGCAAGCAGAAAGAGAACTC

GATGCTTCATTTGACTCACACTCACATTTA; 

or

(SEQ ID NO: 715)

CAAACAAGAATAAAGAGTAGAGGGTGTTTC

GAGAATCTTCAACTTTTTGTATCTTCTATT.